Научный журнал
Международный журнал прикладных и фундаментальных исследований

ISSN 1996-3955
ИФ РИНЦ = 0,570

ЭКСПРЕССИЯ СЕЛЕНОПРОТЕИНА SELI В РАЗЛИЧНЫХ РАКОВЫХ КЛЕТОЧНЫХ ЛИНИЯХ ЧЕЛОВЕКА В УСЛОВИЯХ ЭР-СТРЕССА, ВЫЗВАННОГО МЕТИЛСЕЛЕНИНОВОЙ КИСЛОТОЙ

Гольтяев М.В. 1 Варламова Е.Г. 1
1 Институт биофизики клетки Российской академии наук – обособленное подразделение Федерального государственного бюджетного учреждения науки «Федеральный исследовательский центр “Пущинский научный центр биологических исследований” Российской академии наук»
Метилселениновая кислота (МСК) способна генерировать АФК и имеет много биологических функций: антиоксидантную, противораковую, прооксидантную, обладает противовирусной активностью и участвует в регуляции клеточной сигнализации и окислительно-восстановительной системы. В условиях in vivo МСК быстро восстанавливается до метилселенола путем неферментативных реакций и индуцирует апоптоз раковых клеток путем образования супероксидных анионных радикалов. Кроме того, данное селен-содержащее соединение способно индуцировать стресс эндоплазматического ретикулума (ЭР-стресс). Известно, что 7 из 25 селенопротеинов человека строго локализуются в ЭР, относительно недавно нами показано, что селенопротеин SELI, помимо ядерно-цитоплазматической локализации, находится и в ЭР и, возможно, вовлечен в регуляцию процессов, сопряженных с ЭР-стрессом. Целью данной работы явилось исследование изменения уровней экспрессии SELI в условиях ЭР-стресса, вызванного действием МСК, в трех раковых клеточных линиях человека: DU 145 (карцинома простаты), HT-1080 (фибросаркома), MCF 7 (аденокарцинома молочных желез). Методом ПЦР в реальном времени установлено, что во всех трех раковых клеточных линиях в условиях пролонгированного ЭР-стресса, вызванного действием 1 мкM МСК, наблюдалось увеличение уровня экспрессии мРНК гена данного селенопротеина, что коррелирует с результатами вестерн-блоттинга. Подобный эффект выявлен в клетках HT-1080 и при воздействии на них более низкими концентрациями МСК (0.01 и 0.1 мкМ). Учитывая важную роль селенопротеинов в регуляции процессов канцерогенеза, в первую очередь в качестве антиоксидантов, результаты данной работы являются весьма актуальными.
метилселениновая кислота (МСК)
ЭР-стресс
селенопротеины человека
канцерогенез
1. Shigemi Z., Manabe K., Hara N., Baba Y., Hosokawa K., Kagawa H., Watanabe T., Fujimuro M. Methylseleninic acid and sodium selenite induce severe ER stress and subsequent apoptosis through UPR activation in PEL cells. Chem. Biol. Interact.. 2017. vol. 266. Р. 28–37.
2. Tarrado-Castellarnau M., Cortes R., Zanuy M., Tarrago-Celada J., Polat I.H., Hill R., Fan T.W., Link W., Cascante M. Methylseleninic acid promotes antitumour effects via nuclear FOXO3a translocation through Akt inhibition. Pharmacological Research. 2015. vol. 102. Р. 218–234.
3. Zeng H., Wu M. The inhibitory efficacy of methylseleninic acid against colon cancer xenografts in C57BL/6 mice, Nutrition and Cancer. 2015. vol. 67. Р. 831–838.
4. Ramoutar R.R., Brumaghim J.L. Antioxidant and Anticancer Properties and Mechanisms of Inorganic Selenium, Oxo-Sulfur, and Oxo-Selenium Compounds. Cell Biochem. Biophys. 2010. vol. 58. Р. 1–23.
5. Evans S.O., Khairuddin P.F. and Jameson M.B. Optimising selenium for modulation of cancer treatments. Anticancer Res. 2017. vol. 37. Р. 6497–6509.
6. Fernandes A.P., Gandin V. Selenium compounds as therapeutic agents in cancer. Biochim. Biophys. Acta. 2015. vol. 1850. Р. 1642–1660.
7. Kuznetsova Y.P., Goltyaev M.V., Gorbacheva O.S., Novoselov S.V., Varlamova E.G., Fesenko E.E. Influence of Sodium Selenite on the mRNA Expression of the Mammalian Selenocysteine-Containing Protein Genes in Testicle and Prostate Cancer Cells. Dokl. Biochem. Biophys. 2018. vol. 480. Р. 131–134.
8. Varlamova E.G., Goltyaev M.V., Kuznetsova Y.P. Effect of Sodium Selenite on Gene Expression of SELF, SELW, and TGR Selenoproteins in Adenocarcinoma Cells of the Human Prostate. Mol Biol (Mosk).. 2018. vol. 52. Р. 519–526.
9. Varlamova E.G., Goltyaev M.V., Novoselov V.I., Fesenko E.E. Cloning, Intracellular Localization, and Expression of the Mammalian Selenocysteine-Containing Protein SELENOI (SELI) in Tumor Cell Lines E. Dokl. Biochem. Biophys. 2017. vol. 476. Р. 581–583.

Метилселениновая кислота (МСК) представляет собой соединение селена второго поколения, которое обладает различной биологической и фармакологической активностью [1–3]. Неоднократно показано, что МСК способствует апоптозу различных раковых клеток, вызывая пролонгированный стресс эндоплазматического ретикулума (ЭР-стресс), в результате которого активируется про-апоптотический «мисфолдинг-ответ» (UPR-unfolded protein response). Кроме того, МСК способна регулировать экспрессию селенопротеинов, локализующихся в ЭР, что весьма интересно, учитывая важную роль селена и селенопротеинов в регуляции процессов канцерогенеза [4–8]. Известно, что 7 из 25 селенопротеинов, идентифицированных у млекопитающих, являются резидентами ЭР, их роль в регуляции процессов, сопряженных с ЭР-стрессом, неоднократно доказана в ряде исследований [1–3]. В центре внимания данной работы находится малоизученный селенопротеин человека SELI, который также локализуется в ЭР, а его мРНК экспрессируется в исследуемых раковых клетках в значительной степени, как нами было ранее показано [9].

Цель исследования: исследовать изменение уровней экспрессии мРНК гена hseli и определить количественное содержание белка SELI в раковых клетках человека DU 145, HT-1080 и MCF 7 в условиях ЭР-стресса, вызванного воздействием на клетки МСК.

Материалы и методы исследования

Выделение РНК. Тотальную РНК из раковых клеток DU 145, HT-1080 и MCF 7 («ATCC», США) выделяли с помощью реагента Extract tRNA reagent («Евроген», Россия), содержащего раствор фенола и гуанидинизотиоционата. Реагент вносили на чашку Петри с клеточным монослоем из расчета 1 мл на 10 см2 поверхности, выделение РНК согласно протоколу производителя.

Обратная транскрипция. Реакцию обратной транскрипции проводили с использованием набора реагентов для синтеза первой цепи кДНК («Евроген», Россия), содержащего ревертазу MMLV в присутствии oligo(dT)-праймеров. Используемое в реакции содержание суммарной РНК (2 мкг) контролировали, проводя параллельно амплификацию с праймерами к гену «домашнего хозяйства» GAPDH.

ПЦР в реальном времени. Полученную к ДНК использовали в качестве матрицы для проведения ПЦР в реальном времени с помощью смеси qPCRmix-HSSYBR («Евроген», Россия) и пар праймеров: для гена hgapdh 5’ AACGGGAAGCTCACTGGC 3’ и 5’ CACCACCCTGTTGCTGTAGC 3’; для гена hseli 5’ CCAAATGAGTAGTACCCGGTG 3’ и 5’ CCAAAGAAAGATTATTACAGGCC 3’. ПЦР в реальном времени проводили в следующем режиме: предварительная денатурация при 95 °C, 2 мин, далее 35 циклов в режиме 95 °C 1 мин, 60 °C 30 сек и 72 °C 30 сек. Изменение уровня экспрессии мРНК до и после обработки МСК, определяли по формуле ОУЭ = 2-ΔΔСт, где ΔСт – разница между значениями пороговых циклов для референсного (GAPDH-ген, кодирующий глицеральдегид-3-фосфат дегидрогеназу) и целевого гена hseli, ΔΔСт – разница значений ΔСт до и после обработки клеток МСК. Результаты приведены как среднее значение ± стандартное отклонение трех независимых экспериментов. Различия считались значимыми, когда значение Р < 0,05. Каждый цикл эксперимента (выделение РНК, реакция обратной транскрипции, ПЦР в реальном времени) повторяли трижды.

Вестерн-блоттинг. Для идентификации исследуемых белков использовали метод иммуноблотинга, для чего клетки отмывали фосфатно-солевым буфером и центрифугировали при 1 000 об/мин в течение 20 мин. Супернатант концентрировали с помощью центрифужных концентраторов Amicon Ultra 4-50 кДа («MerkMillipore», Россия), полученные образцы использовали для проведения ПААГ электрофореза в 10 % разрешающем геле. Далее выполняли иммуноблотинг с коммерческими антителами против исследуемых белков и вторичными антителами, конъюгированными с пероксидазой хрена («Abcam», США). Количественная обработка результатов вестерн-блоттинга проводилась с помощью программы «ImageJ» [https://imagej.nih.gov/ij/index.html].

Результаты исследования и их обсуждение

Анализ экспрессии мРНК гена hseli в исследуемых раковых клетках после воздействия на них 0,01; 0,1 и 1 мкМ МСК в течение 24 и 48 ч

Ранее нами и др. авторами показано, что МСК в концентрациях 0,01; 0,1 и 1 мкМ способна вызывать ЭР-стресс, причем в различных раковых клетках механизм регуляции ЭР-стресса и про-апоптотического UPR может протекать с участием трех трансмембранных белков PERK, IRE1 и ATF-6 [1–3]. Недавно нами установлено, что при обработке раковых клеток DU 145, HT-1080 и MCF 7 в течение 24 и 48 ч 0,01; 0,1 и 1 мкМ МСК % цитотоксичности всех трех линий раковых клеток увеличивался прямо пропорционально концентрации МСК и времени обработки.

Таким образом, измерение уровней экспрессии мРНК и количественная оценка белка SELI проводились в условиях пролонгированного стресса, приводящего в конечном итоге к апоптозу клеток. Результаты, полученные с помощью метода ПЦР в реальном времени (рис. 1), свидетельствуют об усилении экспрессии мРНК гена hseli во всех трех линиях особенно после воздействия на клетки 1 мкМ МСК, кроме того почти двукратное увеличение экспрессии данного гена наблюдалось после обработки клеток HT-1080 0,01 и 0,1 мкМ МСК.

golt1.tif

Рис. 1. Относительный уровень экспрессии мРНК гена hseli в клетках DU 145, HT-1080 и MCF 7 до и после обработки клеток 0,01; 0,1 и 1 мкМ МСК в течение 24 и 48 ч

Это может быть объяснено тем, что данная клеточная линия является слабо дифференцированной по сравнению с DU 145 и MCF 7, для которых показатель цитотоксичности при обработке их исследуемыми концентрациями МСК, как было показано ранее, оказался ниже, чем для HT-1080. Таким образом, количество апоптотических клеток для линии HT-1080 после воздействия на них 0,01; 0,1 мкМ МСК приблизительно соответствует таковому после воздействия на клетки DU 145 и MCF 7 0,1 и 1 мкМ МСК. Результаты, полученные с помощью ПЦР в реальном времени, коррелируют с результатами вестерн-блоттинга, представленными на рис. 2 и 3.

golt2.tif

Рис. 2. Содержание белка SELI в клетках DU 145, HT-1080 и MCF 7 до и после их обработки МСК. 1 – содержание белка в интактных клетках; 2,4,6 – содержание белка после 24 ч обработки клеток 0,01; 0,1; 1 мкМ МСК, соответственно; 3,5,7 – содержание белка после 48 ч обработки клеток 0,01; 0,1; 1 мкМ МСК соответственно

golt3.tif

Рис. 3. Относительный уровень содержания белка в клетках DU 145, HT-1080 иMCF 7 до и после 24 ч или 48 ч обработки МСК. Анализ выполнен с помощью программы «ImageJ»

Заключение

SELI является плохо изученным селенопротеином млекопитающих, наряду с семью другими селенопротеинами-резидентами ЭР, также локализуется в данном органоиде клетки. В связи с чем возник интерес исследовать изменение экспрессии мРНК его гена, а также дать количественную оценку содержания белка SELI в трех раковых клеточных линиях человека DU 145, HT-1080 и MCF 7 в условиях ЭР-стресса, вызванного воздействием на клетки различными концентрациями МСК. В результате ряда экспериментов установлено, что во всех трех клеточных линиях наблюдалось усиление экспрессии мРНК и белка соответственно после воздействия на них 1 мкМ МСК, однако в клетках HT-1080 аналогичные изменениях экспрессии наблюдались и при воздействии на них более низкими концентрациями МСК (0,01 и 0,1 мкМ). На основании полученных результатов с учетом внутриклеточной локализации SELI, можно предположить, что данный селенопротеин вовлечен в регуляцию процессов, сопряженных с ЭР-стрессом, в том числе пролонгированным, приводящим к апоптозу раковых клеток, как это было продемонстрировано в ряде работ [1–5]. Данные результаты послужат предпосылкой для дальнейших исследований функций SELI и его вклада в регуляцию процессов ЭР-стресса и канцерогенеза.

Работа выполнена при поддержке гранта РФФИ № 18-34-00118 мол_а и гранта Президиума РАН «Постгеномные технологии и перспективные решения в биомедицине».


Библиографическая ссылка

Гольтяев М.В., Варламова Е.Г. ЭКСПРЕССИЯ СЕЛЕНОПРОТЕИНА SELI В РАЗЛИЧНЫХ РАКОВЫХ КЛЕТОЧНЫХ ЛИНИЯХ ЧЕЛОВЕКА В УСЛОВИЯХ ЭР-СТРЕССА, ВЫЗВАННОГО МЕТИЛСЕЛЕНИНОВОЙ КИСЛОТОЙ // Международный журнал прикладных и фундаментальных исследований. – 2020. – № 1. – С. 5-9;
URL: http://applied-research.ru/ru/article/view?id=12988 (дата обращения: 10.07.2020).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074