Научный журнал
Международный журнал прикладных и фундаментальных исследований

ISSN 1996-3955
ИФ РИНЦ = 0,570

СТРУКТУРА ГЕНА АНТОЦИАНИДИНСИНТАЗЫ У РЖИ

Андреева Е.А. 1, 2 Лыхолай А.Н. 2 Зыкин П.А. 2 Войлоков А.В. 1
1 ФГБУН «Институт общей генетики им. Н.И. Вавилова» Российской академии наук
2 Санкт-Петербургский государственный университет
Антоцианы – древние пигменты растений, основными функциями которых являются участие в опылении, распространении семян и плодов и защита клеток от избыточного света и ультрафиолетового излучения. В Петергофской генетической коллекции ржи присутствуют как формы с мутациями, приводящими к полному отсутствию антоцианов в растении, так и формы с разнообразной окраской вегетативных и генеративных органов, отличающиеся по качественному и количественному составу антоцианов. Необходимым для синтеза окрашенных антоцианов из неокрашенных предшественников является фермент антоцианидинсинтаза, за синтез которого ответственен ген ANS. У шести безантоциановых линий и трех линий с антоциановой окраской отсеквенированы участки гена ANS, соответствующие домену FE2OG_OXY (оксиглутарат/железозависимая диоксигеназа). Сравнительный анализ нуклеотидных и аминокислотных последовательностей выявил нонсенс-мутацию у безантоциановой линии vi2 и значительную вариабельность последовательностей у остальных линий: однонуклеотидные замены, делеции 6 и 9 нуклеотидов. У линий 2 и 87 с антоциановой окраской вегетативных частей растений выявлены аминокислотная замена и 9-нуклеотидная делеция в активном центре фермента. Полученные данные используются для выяснения молекулярно-биологических основ синтеза антоцианов у ржи.
антоцианы
рожь
антоцианидинсинтаза
мутации
безантоциановые линии
1. Campanella J.J., Smalley J.V., Dempsey M.E. A phylogenetic examination of the primary anthocyanin production pathway of the Plantae. Botanical Studies. 2014. vol. 55. P. 1–10. DOI: 10.1186/1999-3110-55-10.
2. Helnæs A., Kyrø C., Andersen I., Lacoppidan S., Overvad K., Christensen J., Tjønneland A., Olsen A. Intake of whole grains is associated with lower risk of myocardial infarction: the Danish Diet, cancer and health cohort. Am. J. Clin. Nutr. 2016. vol. 103. no. 4. P. 999–1007. DOI: 10.3945/ajcn.115.124271.
3. Sandberg J.C., Björck I.M.E., Nilsson A.C. Increased plasma brain-derived neurotrophic factor 10.5 h after intake of whole grain rye-based products in healthy subjects. Nutrients. 2018. vol. 16. no. 10 (8). DOI: 10.3390/nu10081097.
4. Zhu F. Anthocyanins in cereals: Composition and health effects. Food Res Int. 2018. vol. 109. P. 232–249. DOI: 10.1016/j.foodres.2018.04.015.
5. Дрейпер Дж., Скотт Р., Армитидж Ф., Дьюри Г. Генная инженерия растений. Лабораторное руководство. М.: Мир, 1991. 408 c.
6. Khlestkina E.K., Tereshchenko O.Y., Salina E.A. Anthocyanin biosynthesis genes location and expression in wheat-rye hybrids. Mol Genet Genomics. 2009. Vol. 282. no. 5. P. 475–485. DOI: 10.1007/s00438-009-0479-x.
7. Chromas [Электронный ресурс]. URL: https://technelysium.com.au/wp/chromas (дата обращения: 18.12.2018).
8. Basic Local Alignment Search Tool [Электронный ресурс]. URL: https://blast.ncbi.nlm.nih.gov/Blast.cgi (дата обращения: 18.12.2018).
9. IPK Gatersleben. Crop Analysis Tool Suite [Электронный ресурс]. URL: https://webblast.ipk-gatersleben.de (дата обращения: 18.12.2018).
10. ExPASy. SIB Bioinformatics Resource Portal [Электронный ресурс]. URL: https://web.expasy.org (дата обращения: 18.12.2018).
11. Clustal Omega. Multiple Sequence Alignment [Электронный ресурс]. URL: https://www.ebi.ac.uk/Tools/msa/clustalo (дата обращения: 18.12.2018).
12. Maraci О., Оzkan H., Bilgin R. Phylogeny and genetic structure in the genus Secale. PLoS ONE.2018. Vol. 13. no. 7. e0200825. DOI: 10.1371/journal.pone.0200825.
13. Wilmouth R.C., Turnbull J.J., Welford R.W., Clifton I.J., Prescott A.G., Schofield C.J. Structure and mechanism of anthocyanidin synthase from Arabidopsis thaliana. Structure. 2002. vol. 10. no. (1). P. 93–103. DOI: 10.1016/S0969-2126(01)00695-5.
14. Bauer E., Schmutzer T., Barilar I., Mascher M., Gundlach H., Martis M.M., Twardziok S.O., Hackauf B., Gordillo A., Wilde P., Schmidt M., Korzun V., Mayer K.F., Schmid K., Schоn C.C., Scholz U. Towards a whole-genome sequence for rye (Secale cereale L.). Plant. J. 2017. vol. 89. no. 5. P. 853–869. DOI: 10.1111/tpj.13.

Антоцианы – древние пигменты растений флавоноидной природы, придающие различным частям растений окраску синих, фиолетовых, красных цветов. В Петергофской генетической коллекции ржи сохранены линии с разнообразной окраской тканей и органов, обусловленной разным качественным и количественным составом антоцианов. Основными функциями антоцианов в растениях являются привлечение животных – опылителей и распространителей семян и защита клеток от избыточного солнечного света и повреждения ультрафиолетом [1]. Поскольку рожь опыляется ветром, а семена рассеиваются преимущественно без участия животных, то функция защиты от УФ-излучения является в данном случае для антоцианов ржи основной. Рожь (Secale cereale L.) – хлебная злаковая культура, которую человек культивирует со времён неолита. Рожь ценна своим зерном для питания человека, как сырье для производства спирта и крахмала, зелёные части растения идут на корм скоту и в качестве сидерата. В последние несколько лет опубликовано значительное количество статей, посвящённых положительному влиянию на здоровье человека от употребления ржаных продуктов. Положительные эффекты отмечены для больных диабетом 2-го типа, инфарктом миокарда [2], помимо этого, рожь даже поддерживает целостность нейронов [3]. Кроме того, в отличие от более широко возделываемого злака – пшеницы, рожь в значительной степени сохранила природное разнообразие, в том числе и по окраске семян. Окраска семян у ржи в основном зависит от наличия антоцианов, являющихся антиоксидантами. Ряд статей и обзоров подтверждают положительное влияние на здоровье человека потребляемых с пищей антоцианов [4]. На основании литературных данных можно заключить, что зёрна ржи, особенно с антоциановой окраской, являются ценным пищевым продуктом, на основе которого производится так называемая «здоровая» еда (functional food). В этой связи изучение биосинтеза антоцианов у линий ржи с различным типом окраски для определения конкретных генов представляется актуальным.

Путь биосинтеза антоцианов в растениях изучен довольно полно, в частности его изучали у ячменя, риса, кукурузы. Необходимым для синтеза окрашенных антоцианов из неокрашенных предшественников является фермент антоцианидинсинтаза, за синтез которого ответственен ген ANS. В Петергофской генетической коллекции ржи идентифицированы безантоциановые линии, несущие рецессивные мутации в пяти неаллельных генах (vi1, vi2, vi3, vi4, vi5, vi6) и не имеющие антоциановой окраски зерна и вегетативных органов. Мы предположили, что, по крайней мере, у части безантоциановых линий изменения могут быть связаны с мутациями именно в гене ANS. Для проверки этой гипотезы авторами был секвенирован и проанализирован функционально значимый участок гена ANS у шести безантоциановых линий и трех высокоинбредных линий с наличием антоциановой окраски.

Материалы и методы исследования

В работе использованы 6 линий ржи (vi1, vi2, vi3, vi4, vi5, vi6), характеризующиеся отсутствием антоциановой окраски на вегетативных частях растения и в зерне. Линии содержат мутации в пяти неаллельных генах (vi1, vi2, vi3, vi4 = vi5, vi6). В качестве контрольных были использованы высокоинбредные линии 2, 7 и 87. Линии 2 и 7 характеризуются жёлтой (безантоциановой) окраской зерновок и наличием антоциановой окраски на вегетативных частях растений, у линии 87 зелёная окраска зерновок (содержится антоциан дельфинидин рутинозид) и наличие антоциановой окраски на вегетативных частях растений. Для выделения ДНК семена проращивали на чашках в нестерильных условиях. ДНК выделяли из 5–7-дневных проростков с использованием буфера на основе цетиламмоний бромида по протоколу [5]. Качество ДНК оценивали на 1 % агарозном геле. Амплификацию фрагмента гена ANS проводили с использованием праймеров

Ans_F_new GGGAAGAGGGAGTGGGAGGACTACCTGT, Ans_R_new GCGAAGACGACCCAGGAGACGCGCACGG (ООО «Бигль», РФ). Последовательность участка данного гена взята из базы данных NCBI (Sequence ID NCBI: EU815626.1) [6] с уточнениями на основании собственных результатов секвенирования. Амплификацию продукта размером 542 п.н. проводили при температуре отжига 60 °С в амплификаторе «Терцик» (ООО «ДНК-Технология», РФ). Секвенирование ПЦР-продуктов проводили на генетическом анализаторе ABI Prism 3500xl (Applied Biosystems, USA).

Анализ сиквенсов проводили с помощью программы Chromas [7], поиск сходных нуклеотидных и аминокислотных последовательностей проводили в базе NCBI с помощью алгоритма BLAST [8], поиск контигов ржи [9], трансляцию нуклеотидных последовательностей и поиск белковых доменов [10], множественное выравнивание нуклеотидных и аминокислотных последовательностей [11].

Результаты исследования и их обсуждение

Анализ нуклеотидных последовательностей участка гена ANS

Одним из существенных ферментов биосинтеза антоцианов является антоцианидинсинтаза. Для ржи в базе данных по нуклеотидным последовательностям NCBI содержится лишь небольшой (542 п.н.) фрагмент соответствующего гена ANS (Sequence ID: EU815626.1) [6], для других видов, в частности пшеницы, известны полные сиквенсы генов ANS. На основе выравнивания нуклеотидных последовательностей генов ANS пшеницы нами были подобраны праймеры для амплификации фрагмента длиной 580 п.н., отличного от имеющегося в GenBank. Амплификаты, наработанные на ДНК безантоциановых растений линий vi1…vi6 и контрольных линий 2, 7 и 87, были отсеквенированы. Анализ полученных сиквенсов выявил различия в последовательностях, связанных с однонуклеотидными заменами и делециями/инсерциями нуклеотидов длиной 6 и 9 нуклеотидов. Причём эти различия были выявлены не только между безантоциановыми линиями и контрольными линиями, но и среди контрольных линий.

Так, у линий 2 и 87 присутствует делеция в 9 нуклеотидов, которой нет у всех остальных линий; у всех линий кроме линии vi3 присутствует делеция в 6 нуклеотидов (рис. 1). Таким образом, на уровне анализа нуклеотидных последовательностей нам не удалось выявить различия, которые бы маркировали признак «наличие антоциановой окраски». Поскольку длина выявленных делеций кратна 3 (размеру кодона), то следующим нашим шагом стала трансляция нуклеотидных последовательностей и анализ соответствующих аминокислотных последовательностей.

and1.tif

Рис. 1. Фрагмент множественного выравнивания нуклеотидных последовательностей участка гена ANS. Vi1, vi3, vi4, vi5, vi6 – безантоциановые линии, L2, L7, L87 – линии с антоциановой окраской. * отмечены совпадающие нуклеотиды – делеция нуклеотида

Анализ аминокислотных последовательностей участка гена ANS

Для установления рамки считывания отсеквенированные последовательности сравнивали с генами антоцианидинсинтазы пшеницы (Sequence ID NCBI: AB247917.1, AB247919.1, AB247920.1). Трансляция и анализ аминокислотной последовательности линии vi2 позволил обнаружить преждевременный стоп-кодон в рамке считывания. Данный факт позволяет предположить, что отсутствие антоцианов в линии vi2 действительно связано с мутацией в гене антоцианидинсинтазы.

Поскольку нас очень заинтересовал факт обнаружения в сиквенсах линий довольно необычных делеций кратных трём, мы решили выяснить, является ли такая вариабельность «нормальной» для гена антоцианидинсинтазы и могут ли быть связаны делеции с нарушениями в функциональных доменах белка.

Для оценки вариабельности гена антоцианидинсинтазы мы проанализировали нуклеотидные последовательности этого гена у близкого родственника ржи, пшеницы Triticum aestivum L. У пшеницы охарактеризованы 5 генов антоцианидинсинтазы (Sequence ID NCBI: AB247917.1, AB247919.1, AB247920.1, AB247921.1, AB247918.1). Выравнивание нуклеотидных последовательностей выявило несколько делеций/инсерций, но в области исследуемого участка (154–306 а.к.) мы обнаружили только одну 6-нуклеотидную делецию, присутствующую у генов TaANS-A2, TaANS-B1, TaANS-B2, TaANS-D1 и отсутствующую у гена TaANS-A1. Таким образом, вариабельность участка гена антоцианидинсинтаза у ржи значительно выше, чем у пшеницы, что согласуется с данными о том, что в отличие от более широко возделываемого злака – пшеницы, рожь в значительной степени сохранила природное разнообразие не только на фенотипическом, но и на генотипическом уровне [12].

Структура белка антоцианидинсинтаза хорошо изучена на арабидопсисе [13]. Мы сравнили аминокислотные последовательности арабидопсиса и фрагментов гена антоцианидинсинтазы исследуемых линий ржи. Несмотря на довольно длительную (около 100 млн лет) независимую эволюцию однодольных и двудольных растений, аминокислотные последовательности оказались с довольно значительной степенью сходства (49 % по данным выравнивания). Сопоставив выявленные у белка арабидопсиса участки, формирующие вторичные структуры (α-спирали и β-слои), а также, функционально значимые аминокислоты, участвующие в присоединении ионов железа, являющихся кофакторами, с последовательностью ржи (рис. 2), можно заметить, что в основном, делеции находятся в промежутках между функционально значимыми участками и не затрагивают их.

and2.tif

Рис. 2. Множественное выравнивание аминокислотных последовательностей гена антоцианидинсинтазы арабидопсиса (At) и фрагментов гена антоцианидинсинтазы ржи (линии vi1, vi3, vi4, vi5, vi6, L87, L2, L7) и последовательности домена FE2OG_OXY (оксиглутарат/железозависимая диоксигеназа). Жёлтым цветом выделены участки, формирующие α-спирали, розовым – β-слои, синим шрифтом выделены аминокислоты, участвующие в присоединении ионов железа

Исключение составляют 9-нуклеотидные делеции, затрагивающие участок β-слоя, у линий 2 и 87. Интересным фактом является и однонуклеотидная замена, приводящая к замене у тех же линий аспарагиновой кислоты (D) на аспарагин (N) в положении 234 (по последовательности арабидопсиса). Эта замена, по-видимому, является существенной, поскольку аспарагиновая кислота участвует в присоединении ионов железа, необходимых для каталитической функции антоцианидинсинтазы. В этом положении у всех остальных проанализированных последовательностей ржи, арабидопсиса и пшеницы находится именно аспарагиновая кислота. Аспарагиновая кислота и аспарагин довольно сильно отличаются по физико-химическим свойствам, а значит, эта замена должна значительно отразиться на каталитических свойствах фермента и фенотипе растений. Однако линии 2 и 87 проявляют антоциановую окраску на вегетативных частях растений и на зерновках (линия 87). Можно предположить, что у ржи, как и у других злаковых, в геноме присутствует не одна копия гена антоцианидинсинтаза, а несколько. При функциональном повреждении одной копии не происходит блокирование синтеза антоцианов на всём растении, а лишь на некоторых частях. Это предположение подтверждается данными по секвенированию генома ржи в 2017 г. [14]. В базе данных нуклеотидных последовательностей ржи [9] нам удалось обнаружить три последовательности, отнесённые авторами к гену антоцианидинсинтазы на основе сходства с пшеницей T. urartum и Aegilops tauschii. Одну из этих последовательностей отнесли к хромосоме 4. К сожалению, сиквенсы последовательностей, представленные в базе данных, довольно короткие и их сравнительный анализ не позволяет надёжно подтвердить версию о нескольких копиях антоцианидинсинтазы в геноме ржи.

Заключение

Проанализировав нуклеотидные и аминокислотные последовательности участка гена антоцианидинсинтазы ржи, соответствующего домену FE2OG_OXY (оксиглутарат/железозависимая диоксигеназа), мы пришли к следующим заключениям:

1) преждевременный стоп-кодон у линии vi2 позволяет предполагать, что основа безантоциановости связана с мутацией в гене антоцианидинсинтазы;

2) выявлена значительная вариабельность структуры последовательности домена FE2OG_OXY у ржи по сравнению с пшеницей. Межлинейные различия включают в себя однонуклеотидные замены и делеции/инсерции длиной 6 и 9 нуклеотидов;

3) различия в последовательностях домена FE2OG_OXY у линий ржи в большинстве случаев не затрагивают функционально значимые участки;

4) исключением являются делеция в 6 нуклеотидов и несинонимичная замена в пределах функционально значимых участков у линий 2 и 87 с антоциановой окраской вегетативных частей растений. Поскольку значимые замены не привели к отсутствию антоцианов у этих линий, можно предположить, что в геноме ржи присутствует несколько копий генов антоцианидинсинтазы, что подтверждается результатами геномного секвенирования.

Дальнейшие исследования молекулярных основ проявления безантоциановости будут связаны с секвенированием и анализом полноразмерных копий гена ANS у линий ржи, прежде всего у линии vi2.

Данная работа была выполнена при поддержке гранта РФФИ № 16-04-00411 и в рамках темы «Генетика и селекция ржи на основе наследственного природного разнообразия». Часть работы проведена в Ресурсном центре «Развитие молекулярных и клеточных технологий» СПбГУ.


Библиографическая ссылка

Андреева Е.А., Лыхолай А.Н., Зыкин П.А., Войлоков А.В. СТРУКТУРА ГЕНА АНТОЦИАНИДИНСИНТАЗЫ У РЖИ // Международный журнал прикладных и фундаментальных исследований. – 2018. – № 12-2. – С. 261-265;
URL: https://applied-research.ru/ru/article/view?id=12557 (дата обращения: 11.07.2020).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074