Научный журнал
Международный журнал прикладных и фундаментальных исследований
ISSN 1996-3955
ИФ РИНЦ = 0,564

НАРУШЕНИЯ В РЕГУЛЯТОРНОЙ СЕТИ КОНКУРЕНТНО-ВЗАИМОДЕЙСТВУЮЩИХ РНК И РАДИОРЕЗИСТЕНТНОСТЬ ОПУХОЛЕЙ ПРЯМОЙ КИШКИ

Кутилин Д.С. 1 Гусарева М.А. 1 Кошелева Н.Г. 1 Зинькович М.С. 1 Савченко Д.А. 1 Шляхова О.В. 1 Фатькина Н.Б. 1 Удаленкова И.А. 1 Гаппоева М.А. 1 Толмачева Е.А. 1
1 ФГБУ «Национальный медицинский исследовательский центр онкологии» Министерства здравоохранения Российской Федерации
Несмотря на многолетнее совершенствование алгоритмов лучевой терапии опухолей прямой кишки полный клинический ответ достигается лишь у небольшого числа пациентов, что связано с формированием радиорезистентности злокачественных клеток. Сейчас, как никогда ранее, актуально проведение комплексного исследования, интегрирующего различные молекулярные параметры и позволяющего как объяснить ряд молекулярных механизмов радиорезистентности, так и предложить перечень новых маркеров. В последнее десятилетие с помощью высокопроизводительного секвенирования было показано существование регуляторной сети конкурентно-взаимодействующих РНК, состоящей из длинных некодирующих РНК, микроРНК и мРНК. Поэтому целью исследования стал анализ особенностей функционирования регуляторной сети конкурентно-взаимодействующих РНК у больных раком прямой кишки, радиорезистентных и чувствительных к лучевой терапии. Исследование было выполнено на 100 пациентах с диагностированными злокачественными опухолями прямой кишки. Лучевая терапия проводилась на линейном ускорителе частиц Novalis TX по алгоритму: разовая очаговая доза 2.4 Гр до суммарной очаговой дозы 54.0 Гр. Для выделения РНК использовали парные фрагменты биопсии условно-нормальных и опухолевых тканей прямой кишки, полученные при видеоколоноскопии. Анализ относительной представленности транскриптов мРНК, микроРНК и lncRNA оценивали методом RT-qPCR. Также был проведен биоинформационный анализ потенциальных взаимодействий исследуемым мРНК, микроРНК и lncRNA. Было установлено, что эффективность лучевой терапии связана с уровнем транскрипционной активности микроРНК (miR-195; miR-1273h; miR-6737; miR-6808; miR-3202; miR-5195; miR-4257; miR-5187; miR-149; miR-138; miR-6798; miR-6819; miR-4728; miR-1249; miR-557; miR-130b) и lncRNA (XIST, HELLPAR, NEAT1, AC008124.1, LINC01089, LINC01547 и VASH1-AS1), обеспечивающих эффективную регуляцию системы репарации ДНК (H2AX и RBBP-8) и апоптоза (BCL-2). Проведенное нами комплексное исследование особенностей регуляторной сети конкурентно-взаимодействующих РНК и эффективности лучевой терапии опухолей прямой кишки позволило установить как механизмы формирования радиорезистентности, так и её предикторы.
рак прямой кишки
мРНК
микроРНК
длинные некодирующие РНК
лучевая терапия
радиорезистентность
апоптоз
репарация ДНК
1. Кутилин Д.С., Гусарева М.А., Кошелева Н.Г., Габричидзе П.Н., Донцов В.А., Легостаев В.М., Шляхова О.В., Лиман Н.А., Солнцева А.А., Васильева Е.О. Влияние аберрантной экспрессии микроРНК на эффективность лучевой терапии опухолей прямой кишки // Современные проблемы науки и образования. 2020. № 6. [Электронный ресурс]. URL: http://www.science-education.ru/ru/article/view?id = 30384 (дата обращения: 15.09.2021).
2. Romano G.M., Bianco F., De Franciscis S., Belli A. The Management of Recurrent Rectal Cancer: A European Perspective. In: Kwaan M., Zbar A. (eds) Comprehensive Rectal Cancer Care. Springer, Cham; 2019. P. 521–536.
3. Schwartz M.H., Wang H., Pan J.N., Clark W.C., Cui S., Eckwahl M.J., Pan D.W., Parisien M., Owens S.M., Cheng B.L., Martinez K., Xu J., Chang E.B., Pan T., Eren A.M. Microbiome characterization by high-throughput transfer RNA sequencing and modification analysis. Nat Commun. 2018. V. 9. P. 5353.
4. Новикова И.А., Тимошкина Н.Н., Кутилин Д.С. Дифференциальная экспрессия микроРНК в опухолевых и нормальных тканях толстой кишки // Якутский медицинский журнал. 2020. № 4 (72). С. 74–82.
5. Cao C., Zhang T., Zhang D., Xie L., Zou X., Lei L., Wu D., Liu L. The long noncoding RNA, SNHG6-003, functions as a competing endogenous RNA to promote the progression of hepatocellular carcinoma. Oncogene. 2017. V. 36 (8). P. 1112–1122.
6. Бейлерли О.А., Гареев И.Ф., Павлов В.Н., Shiguang Z., Xin C., Кудряшов В.В. Экзосомальные длинные некодирующие РНК как биомаркеры и терапевтические мишени при раке // Креативная хирургия и онкология. 2019. Т. 9 (4). С. 297–304.
7. Liu Q., Deng J., Wei X., Yuan W., Ma J. Integrated analysis of competing endogenous RNA networks revealing five prognostic biomarkers associated with colorectal cancer. J Cell Biochem. 2019. V. 120 (7). P. 11256.
8. Tang F., Lu Z., Wang J., Li Zh., Wu W., Duan H., He Zh. Competitive endogenous RNA (ceRNA) regulation network of lncRNAs, miRNAs, and mRNAs in Wilms tumour. BMC Med Genomics. 2019. V. 12. P. 194.
9. Kutilin D.S. Regulation of gene expression of cancer/testis antigens in colorectal cancer patients. Molecular Biology. 2020. V. 54 (4). P. 520–534.
10. Balcells I., Cirera S., Busk P.K. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers. BMC biotechnology. 2011. V. 11 (1). P. 707.
11. Krishnan A., Zhang R., Yao V., Theesfeld C.L., Wong A.K., Tadych A., Volfovskiy N., Packer A., Lash A., Troyanskaya O.G. Genome-wide prediction and functional characterization of the genetic basis of autism spectrum disorder. Nature Neuroscience. 2016. V. 19 (11). P. 1454–1462.
12. Ding J., Li X., Hu H. TarPmiR: a new approach for microRNA target site prediction. Bioinformatics. 2016. V. 32 (18). Р. 2768–2775.
13. Backes C., Khaleeq Q.T., Meese E., Keller A. miEAA: microRNA enrichment analysis and annotation. Nucleic Acids Res. 2016. V. 44 (W1). P. W110-6.
14. Urbańska K., Orzechowski A. Unappreciated Role of LDHA and LDHB to Control Apoptosis and Autophagy in Tumor Cells. Int. J. Mol. Sci. 2019. V. 20 (9). P. 2085.
15. Scully R., Xie A. Double strand break repair functions of histone H2AX. Mutat. Res. 2013. V. 750 (1–2). P. 5–14.
16. Abdelsattar Z.M., Wong S.L., Regenbogen S.E., Jomaa D.M., Hardiman K.M., Hendren S. Colorectal cancer outcomes and treatment patterns in patients too young for average-risk screening. Cancer. 2016. V. 122. P. 929–934.

В 2020 г. было зарегистрировано более 310 тыс. смертей от рака прямой кишки (РПК), что делает данную нозологию лидирующей по показателю летальности среди других онкологических заболеваний [1]. Для облегчения симптомов и локального контроля РПК в настоящее время применяется лучевая терапия (ЛТ) [2]. Несмотря на многолетнее совершенствование алгоритмов ЛТ РПК полный клинический ответ достигается лишь у небольшого числа пациентов, что связано с формированием радиорезистентности злокачественных клеток. За последние 30 лет был проведен внушительный объем исследований по изучению механизмов радиорезистентности и предложен значительный перечень её молекулярных маркеров, ни один из которых, однако, так и не вошёл в клиническую практику. В настоящее время, как никогда ранее, актуально проведение комплексного исследования, интегрирующего различные молекулярные параметры и позволяющего как объяснить ряд молекулярных механизмов радиорезистентности, так и предложить перечень новых маркеров.

В последнее десятилетие сложность человеческого генома была выявлена с помощью высокопроизводительного секвенирования РНК [3]. Было показано существование регуляторной сети конкурирующих эндогенных РНК (ceRNA), состоящей из длинных некодирующих РНК (lncRNA), микроРНК (miRNA) и мРНК.

МикроРНК – это короткие некодирующие РНК, которые регулируют экспрессию генов, катализируя разрушение мРНК либо ингибируя трансляцию мРНК в белок. МикроРНК вносят значительный вклад в инициацию и развитие различных молекулярных событий, включая инициацию онкогенеза, прогрессирование и метастазирование опухолей, что делает микроРНК потенциальными биомаркерами для оценки прогрессирования и прогноза злокачественных опухолей кишечника. Хотя микроРНК регулируют экспрессию генов, кодирующих белки, главным образом посредством деградации или сайленсинга мРНК, появляется все больше свидетельств того, что микроРНК могут взаимодействовать с lncRNA, что, в свою очередь, также обеспечивает регуляцию экспрессии генов-мишеней [4]. Длинные некодирующие РНК (lncRNAs) – это РНК размером более 200 нуклеотидов, регулирующие биологическую активность клеток различными способами, включая транскрипционную регуляцию, посттранскрипционную регуляцию и регуляцию трансляции. lncRNA контролируют посттранскрипционную регуляцию, являясь компонентом сети ceRNAs и выступая в качестве молекулярной «губки» (сорбента) микроРНК [5, 6].

Участие регуляторной сети ceRNA в инициации и прогрессии опухолей кишечника было подтверждено в ряде исследований [7]. Однако роль дисбаланса регуляторной сети ceRNA (lncRNA – miRNA – mRNA) у больных раком прямой кишки и формированием радиорезистентности еще предстоит выяснить [8].

Изучение регуляторной сети микроРНК – длинные некодирующие РНК – мРНК имеет большое значение как для выяснения молекулярных механизмов, лежащих в основе канцерогенеза, так и для создания панели новых биомаркеров [4].

Поэтому целью исследования стал анализ особенностей функционирования регуляторной сети конкурентно-взаимодействующих РНК (lncRNA, miRNA и мРНК) у больных раком прямой кишки, радиорезистентных и чувствительных к лучевой терапии.

Материалы и методы исследования

В исследование было включено 100 пациентов (60 мужчин и 40 женщин в возрасте от 34 до 82 лет, медиана возраста 60,1 ± 5,0 лет) с диагностированным РПК (аденокарциномы), проходивших стационарное лечение в ФГБУ «НМИЦ онкологии» в 2019–2021 гг. ЛТ на линейном ускорителе частиц Novalis TX проводилась по стандартному протоколу (РОД 2.4 Гр, СОД 54.0 Гр). До проведения ЛТ всем пациентам была выполнена видеоколоноскопия (ВКС), во время которой были получены парные фрагменты биопсии условно-нормальных и опухолевых тканей прямой кишки. Эти фрагменты в дальнейшем использовались для выделения РНК.

Выделение суммарных препаратов РНК, анализ уровня мРНК и микроРНК. Фрагменты тканей гомогенизировали в тризоле (QIAzol, Qiagen) при температуре 0–1 °С методом механического воздействия. Из полученных гомогенатов с помощью набора RNeasy Plus Universal Kits (Qiagen) проводили выделение суммарных препаратов РНК. Выделенную РНК обрабатывали ДНКазой-1, тем самым устраняя контаминацию геномной ДНК. На матрице очищенных препаратов РНК осуществляли синтез комплементарной ДНК, используя набор «РЕВЕРТА-Л» (Интерлабсервис, Россия).

Для оценки уровня транскриптов 19 генетических локусов использовали метод ПЦР в реальном времени (Real-Time qPCR, RT-qPCR) (табл. 1). Последовательности высоко-специфичных синтетических олигонуклеотидов были разработаны с использованием программы Primer-BLAST и базы данных GenBank (National Center for Biotechnology Information) (табл. 1).

Таблица 1

Синтетические олигонуклеотиды для определения уровня транскриптов мРНК

Праймеры

Последовательности праймеров

Праймеры

Последовательности праймеров

1

BRCA1(F)

ACCTGTCTCCACAAAGTGTCT

19

KU70(F)

ACGTAGAGGGCGTTGATTGG

2

BRCA1(R)

ACACTGTGAAGGCCCTTTTA

20

KU70(R)

TGGCTACTGCTCACTTTGGCС

3

BRCA2(F)

AGTTGGCTGATGGTGGATGA

21

RAD50(F)

GCGTGCGGAGTTTTGGAATAG

4

BRCA2(R)

GGATCCACACCTGGAGTGCC

22

RAD50(R)

TTGAGCAACCTTGGGATCGT

5

CASP3(F)

CTGGAATATCCCTGGACAACAGT

23

RAP80(F)

GAGTGAGCAGGAAGCTAGGG

6

CASP3(R)

TCGACATCTGTACCAGACCGA

24

RAP80(R)

AGAAGGCCGGCAAСTATTCA

7

CASP8(F)

CTGAAGCAAACAGCCAGTGC

27

RNF168(F)

GCCAGTTCGTCTGCTCAGTA

8

CASP8(R)

GACCTCAATTCTGАTCTGCTCAC

28

RNF168(R)

CTGCCGCCACCTTGCTTAT

9

CASP-9(F)

TGAGACСCTGGACGACATCT

29

H2AX(F)

AGGCCTCCCAGGAGTACTAA

10

CASP-9(R)

TCCCTTTCACCGAAACAGCA

30

H2AX(R)

CTGAAGCGGCTCAGCTCTTT

11

BAX(F)

GGGACGAACTGGACAGTAACA

31

ACTB(F)

AACCGCGAGAAGATGACСC

12

BAX(R)

GCTGCCACTСGGAAAAAGAC

32

ACTB(R)

AGCACAGCCTGGTAGCAAC

13

BCL-2(F)

GGATCCAGGATAACGGAGGC

33

GAPDH(F)

GTCAAGGCTGAGAACGGGAA

14

BCL-2(R)

GAAATCAAACAGAGGCCGCA

34

GAPDH(R)

TCGCCCCACTTGATTTTGGA

15

P53(F)

TTGGAACTCAAGGATGCCCA

35

B2M(F)

AGATGAGTATGCCTGCCGTG

16

P53(R)

CGGGAGGTAGACTGAСCCT

36

B2M(R)

CCATGATGCTGCTTACATGTCTC

17

MDM2(F)

TAGGAGATTTGTTTGGCGTGC

37

RBBP-8(F)

ACCGAGGATTTGGCACTСTG

18

MDM2(R)

CCTGCTGATTGACTACTACСAA

38

RBBP-8(R)

TCCGAGATTGCCTCGGGATT

RT-qPCR-смесь состояла из ПЦР-буфера (1х), dNTP (0,2 мМ), MgCl2 (1,5 мМ), синтетических олигонуклеотидов (по 0,6 мМ каждого), Taq-полимеразы (0,1 U/мкл) и комплементарной ДНК (15 нг). Амплификация кДНК проводилась в термоциклере CFX 96 (Bio-Rad) по следующему алгоритму: 94,0 °С – 240 с и далее 39 циклов: 94,0 °С – 9 с, 57 °С – 25 с, 72 °С – 45 с. Относительный уровень транскриптов мРНК (экспрессия генетических локусов) (TA) вычисляли по формуле, учитывающей нормализацию по референсным генам (GAPDH, ACTB и B2M) и уровню мРНК соответствующих генов в образцах нормальной ткани:

TA = E-ΔΔCt = медиана E(C(t)target–C(t)reference)опухолевой ткани / медиана E(C(t)target–C(t)reference)нормальной ткани .[9].

Уровень относительной экспрессии микроРНК и lncRNA также оценивали методом RT-qPCR. Дизайн последовательностей синтетических олигонуклеотидов, необходимых для оценки экспрессии микроРНК, проводили, используя алгоритм Balcells I. Primer-BLAST использовали для дизайна праймеров на длинные некодирующие РНК. В качестве референса для определения экспрессии микроРНК и lncRNA использовали малую некодирующую РНК U6. Для оценки уровня представленности транскриптов микроРНК тотальную РНК конвертировали в кДНК в реакции обратной транскрипции с RT-праймерами одновременно с полиаденилированием [10].

Статистический и биоинформационный анализ выполняли в среде RStudio v. 8.10.173.987 на языке программирования R. Соответствие полученных данных закону нормального распределения оценивали с помощью критерия Шапиро – Уилка. Значимость межгрупповых отличий определяли с использованием критерия Манна – Уитни (поправка Бонферрони). Взаимосвязи исследуемых показателей оценивали с использованием коэффициента корреляции Спирмена (r). Кластерный анализ выполняли с параметрами Hierarchical Clustering/Euclidean distance. Для группировки генетических локусов по биологическим функциям использовали алгоритм FMD (Functional module detection). Q-value вычисляли с помощью одностороннего точного критерия Фишера (поправка Бенджамини – Хохберга) [11].

Для биоинформационного скрининга микроРНК использовали алгоритм машинного обучения random forest (объединяет метод случайных подпространств и метод бэггинга Бреймана), позволяющий прогнозировать сайт связывания мРНК и микроРНК [12]. Участие дифференциально экспрессирующихся микроРНК в ключевых клеточных сигнальных путях оценивали с помощью ORA (Over-Representation Analysis) [13].

Анализ взаимодействия микроРНК и lncRNA проводили следующим образом:

1) из базы Gene Expression Omnibus были извлечены данные HITS-CLIP, PAR-CLIP и CLASH и обработаны с помощью FASTX-Toolkit v0.0.13, и далее проанализированы с использованием PARalyzer v1.1;

2) с помощью UCSC LiftOver Tool все координаты сайтов связывания были преобразованы в сборки hg19, mm9/mm10 и ce6/ce10 соответственно. Геномные координаты консервативных сайтов-мишеней микроРНК, предсказанные TargetScan, miRanda/mirSVR, PITA, Pictar и RNA22, были также собраны и преобразованы в сборки hg19, mm9/mm10 и ce6/ce10 с использованием LiftOver;

3) полученные на шаге 2 координаты сравнивали с ранее описанными кластерами CLIP с использованием BEDTools [4].

Результаты исследования и их обсуждение

Связь уровня мРНК и эффективности ЛТ. Данные по уровню мРНК 19 генов в образцах биопсии опухолевой ткани прямой кишки были подвергнуты кластерному анализу (Hierarchical Clustering/Euclidean distance), позволившему выделить два основных кластера: в кластере-1 у 80 % образцов был повышен уровень мРНК гена CASP-9 и у 75 % снижен уровень мРНК генов BCL-2, BRCA-2, RBBP-8, H2AX; в кластере-2 у 80 % был снижен уровень мРНК CASP-9, а у 82 % повышен уровень H2AX, BCL-2, BRCA-2, RBBP-8 и RAD50.

Комплексный анализ результатов радиотерапии 100 больных РПК дал следующие результаты: у 30 пациентов был получен полный ответ на терапию, у 45 пациентов – частичный ответ, и у 25 пациентов было зафиксировано отсутствие ответа на терапию. В биопсии опухолевого материала у пациентов с полным ответом на терапию был зафиксирован пониженный уровень мРНК генов H2AX и RBBP-8 в 2,50 и 2,00 раза (р = 0,0048), соответственно, и повышенный уровень мРНК CASP-9 в 5,00 раз (р = 0,00078). В опухолевом биопсийном материале у пациентов с частичным ответом/отсутствием ответа на ЛТ был повышен уровень мРНК генов BCL-2, BRCA-2, H2AX, RBBP-8 и RAD50 в 5,20 (р = 0,00008), 2,50 (р = 0,0044), 2,70 (р = 0,0041), 3,20 (р = 0,0011) и 2,10 (р = 0,0051) раза соответственно (рис. 1).

missing image file

Рис. 1. Относительный уровень мРНК 6 генетических локусов в опухолевой ткани больных РПК с полным ответом на терапию (группа 1, n = 30) и частичным ответом/отсутствием ответа (группа 2, n = 70). * – статистически значимые отличия относительно условно-нормальной ткани прямой кишки (р < 0,05), ** – межгрупповые статистически значимые отличия (р < 0.05)

Таким образом, можно сделать вывод, что уровень мРНК локусов RAD50, BCL-2, BRCA-2, H2AX, CASP-9 и RBBP-8 связан с эффективностью радиотерапии, которая возрастает у больных РПК с гиперэкспрессией гена CASP-9 и гипоэкспрессией генов H2AX и RBBP-8, и, наоборот, эффективность терапии падает при гиперэкспрессии генов RAD50, BCL-2, H2AX, RBBP-8 и BRCA-2.

Связь уровня микроРНК и эффективности ЛТ. Биоинформационный скрининг позволил обнаружить 1927 микроРНК, потенциально взаимодействующих с генетическими локусами H2AX, BCL-2, BRCA-2, RAD50, CASP-9 и RBBP-8. Из 1927 только для 109 микроРНК было подтверждено взаимодействие с соответствующими генами-мишенями в базе данных miRDB (рис. 2). При этом 44 микроРНК образовывали наиболее прочные комплексы с соответствующими генами-мишенями (минимальная свободная энергия взаимодействия в паре микроРНК – мРНК): 18 микроРНК для гена RAD50, 12 микроРНК для CASP-9, 9 микроРНК для гена BCL-2, 2 микроРНК для BRCA-2, 2 микроРНК для H2AX, 1 микроРНК для RBBP-8 (табл. 2).

missing image file

Рис. 2. МикроРНК и их гены-мишени, влияющие на эффективность радиотерапии

Таблица 2

МикроРНК, выявленные при биоинформационном скрининге*

МикроРНК

Ген-мишень

Координаты в геноме

Энергия

miRDB

начало

конец

miRNA-1249

BCL-2

3468

3517

-30.1

+

miRNA-6861

3474

3513

-29.6

+

miRNA-8052

 

4393

4412

-29.3

+

miRNA-324

4680

4700

-28.6

+

miRNA-6820

1670

1701

-28.1

+

miRNA-4717

2322

2364

-28.0

+

miRNA-3943

2750

2774

-27.8

+

miRNA-557

2549

2584

-27.6

+

miRNA-4690

2147

2172

-27.3

+

miRNA-6757

BRCA-2

10786

10812

-25.7

+

miRNA-7151

10797

10825

-25.1

+

miRNA-6779

CASP-9

1482

1537

-34.3

+

miRNA-1273h

2555

2590

-33.1

+

miRNA-6812

2593

2622

-30.6

+

miRNA-6737

1329

1347

-30.1

+

miRNA-661

1516

1552

-29.8

+

miRNA-6799

2609

2656

-29.7

+

miRNA-6893

2442

2484

-28.5

+

miRNA-6819

1329

1347

-27.0

+

miRNA-6874

2505

2535

-26.6

+

miRNA-4728

2906

2925

-26.3

+

miRNA-6808

1588

1610

-26.2

+

miRNA-30b

1967

1987

-25.6

+

miRNA-3202

H2AFX

620

639

-20.3

+

miRNA-5195

1478

1504

-23.8

+

miRNA-130b

RBBP-8

3196

3215

-23.7

+

miRNA-195

RAD50

4473

4495

-21.6

+

miRNA-340

 

7439

7465

-21.6

+

miRNA-497

7937

7955

-21.7

+

miRNA-4257

4983

4995

-21.9

+

miRNA-5187

5263

5294

-22.1

+

miRNA-149

6304

6325

-22.6

+

miRNA-6769a

7407

7432

-22.7

+

miRNA-5010

6718

6737

-23.1

+

miRNA-4533

4505

4523

-23.9

+

miRNA-6856

5076

5107

-23.9

+

miRNA-138-1

6188

6209

-24.2

+

miRNA-433

5013

5034

-24.4

+

miRNA-3911

6964

6988

-24.4

+

miRNA-3691

5368

5391

-24.6

+

miRNA-4786

6889

6915

-25.7

+

miRNA-6758

5054

5108

-26.0

+

miRNA-6865

6715

6736

-29.0

+

miRNA-6798

5134

5170

-30.4

+

* – представлены только микроРНК, валидированные в базе данных miRDB с минимальной свободной энергией взаимодействия микроРНК – мРНК.

Для этих 44 микроРНК проведена оценка представленности их транскриптов в тканях у больных РПК. Обнаружена дифференциальная экспрессия ряда микроРНК как межгрупповая, так и относительно нормальной ткани. В группе больных с частичным ответом/отсутствием ответа после радиотерапии (n = 70, низкая эффективность ЛТ) обнаружено снижение уровня miRNA-1249-5p и miRNA-6820-3p в 2,20 (p = 0,0035) и 2,00 (p = 0,0015) раза соответственно относительно нормальной ткани, снижение уровня miRNA-6820-3p в 1,80 (p = 0,0002) раза относительно пациентов с полным ответом на терапию, снижение уровня miRNA-4717-5p, miRNA-3943 и miRNA-557

в 2,50 (p = 0,00085), 3,30 (p = 0,00001) и 2,50 (p = 0,0023) раза соответственно относительно нормальной ткани, снижение уровня miRNA-557 в 2,3 (p = 0,00047) раза относительно пациентов с полным ответом на ЛТ (n = 30). Также выявлено увеличение уровня представленности транскриптов miRNA-4690-5p в 2,1 (p = 0,00017) раза относительно нормальной ткани и снижение miRNA-4717-5p в 1,7 раза (р = 0,000546) относительно нормальной ткани у пациентов с полным ответом на ЛТ (рис. 1).

То есть данные микроРНК, взаимодействующие с геном BCL-2, в опухолевой ткани у больных с плохим ответом на ЛТ, преимущественно гипоэкспрессированы как относительно нормальной ткани, так и относительно опухолевой ткани пациентов с полным ответом на ЛТ. Соответственно, низкий уровень транскриптов данных микроРНК может приводить к увеличению количества транскриптов генетического локуса BCL-2, продукт которого ингибирует каспазы и апоптоз [14]. Это согласуется с полученными данными: низкой эффективностью ЛТ у больных РПК с гиперэкспрессией BCL-2.

В ткани опухоли больных РПК с низкой эффективностью терапии обнаружено увеличение уровня miRNA-1273h в 2,30 раза (p = 0,0044), miRNA-4728 в 4,00 раза (p = 0,00145), miRNA-6819 в 2,90 раза (p = 0,000012), miRNA-6737 в 3,00 раза (p = 0,0004), miRNA-6874в 3,30 раза (p = 0,0051004) и miRNA-6808-5p в 5,01 раз (p < 0,0000047) относительно опухолевой ткани больных с высокой эффективностью терапии. Уровень miRNA-6812 был снижен в опухолевой ткани у больных с полным и частичным ответом на ЛТ в 1,90 (p = 0,0049) и 1,70 (p = 0,0001) раза соответственно относительно нормальной ткани прямой кишки. Геном-мишенью этих микроРНК является CASP-9, соответственно, высокий уровень их транскриптов должен способствовать снижению уровня мРНК инициаторной каспазы каспазы-9, необходимой для запуска апоптоза.

Уровень miRNA-6757 в опухолевой ткани у больных РПК с низкой эффективностью радиотерапии был ниже в 5,00 (p = 0,0009) раз и 4,41 (p = 0,0040) раза относительно собственной нормальной ткани и опухолевой ткани пациентов с высокой эффективностью терапии соответственно. Геном-мишенью данной микроРНК является BRCA-2, и снижение уровня её транскриптов должно приводить к увеличению уровня мРНК BRCA-2 (рис. 1). Уровень miRNA-1273h, miRNA-6737, miRNA-661, miRNA-4728, miRNA-30b и miRNA-6808 был снижен в 2,50 (p = 0,00001), 3,32 (p = 0,0004), 1,71 (p = 0,0005), 5,00 (p = 0,0001), 1,80 (p = 0,0019) и 5,00 (p = 0,00013) раза соответственно в опухолевой ткани пациентов с полным ответом на терапию относительно нормальной ткани.

В группе больных РПК с высокой эффективностью ЛТ выявлены статистически значимые (p < 0,05) изменения в уровне микроРНК miRNA-5195 и miRNA-3202. Так в опухолевой ткани уровень транскриптов miRNA-3202 был в 4,50 раза выше, чем в нормальной ткани, и в 3,00 раза выше, чем в опухолевой ткани у больных РПК с низкой эффективностью терапии. Уровень miRNA-5195 был в 1,80 раза выше по сравнению с нормальной тканью и в 3,60 раза выше, чем уровень в опухолевой ткани у больных РПК с низкой эффективностью ЛТ (рис. 3). Данные микроРНК могут взаимодействовать с мРНК гистонового белка H2AX, запускающего конформационную модификацию хроматина при повреждении ДНК под воздействием ионизирующего излучения [15]. Поэтому высокий уровень miRNA-3202/miRNA-5195 может способствовать снижению уровня мРНК H2AX, и наоборот.

missing image file

Рис. 3. Транскрипционный профиль микроРНК опухолевой ткани в двух группах больных РПК с разной эффективностью терапии. * – статистически значимые отличия относительно нормальной ткани (р < 0,05), ** – статистически значимые отличия между группами (р < 0,05)

В ходе проведенного исследования также обнаружено, что в опухолевой ткани у больных РПК с высокой эффективностью терапии повышен уровень miRNA-130b в 4,00 раза (p = 0,000014) относительно нормальной ткани и снижен уровень и этой микроРНК в 2,00 раза (p = 0,000195) в опухолевой ткани у больных с низкой эффективностью терапии. Соответственно, у больных первой группы уровень miRNA-130b в 8,00 раза выше (p = 0,00022) по сравнению с уровнем у больных второй группы, что может приводить к снижению уровня мРНК гена RBBP-8 (регулирует пролиферацию клеток) у больных с высокой эффективностью ЛТ и повышению его уровня у больных РПК с низкой эффективностью терапии (рис. 1).

Из 18 микроРНК таргетирующих ген RAD50, в опухолевой ткани прямой кишки аберрантную экспрессию имеют только 8 (miRNA-195-5p, miRNA-5187-5p, miRNA-149-5p, miRNA-138-1-3p, miRNA-433-3p, miRNA-3911, miRNA-6865-5p, miRNA-6798-5p).

Так, экспрессия miRNA-195-5p относительно нормальной ткани прямой кишки в 2,40 (p = 0,0045) раза выше у больных с полным регрессом опухоли и в 5,00 раз (p = 0,0003) ниже у больных с неполным регрессом опухоли. При этом между этими группами отличия в экспрессии miRNA-195-5p составляют 12,00 раз (p = 0,00004) (рис. 3). Экспрессия miRNA-5187-5p и miRNA-149-5p повышена в 4,30 и 5,10 раз (p = 0,00015) в опухолевой ткани у больных с полным ответом на терапию относительно нормальной ткани. Отличие между двумя группами больных по экспрессии этих микроРНК составляет 2,80 раза (p = 0,0001). Экспрессия miRNA-138-1-3p, miRNA-433-3p и miRNA-3911 статистически значимо (p < 0,05) повышена у больных с полным регрессом относительно экспрессии в нормальной ткани в 2,50; 2,10 и 3,40 раза соответственно. Экспрессия miRNA-6798-5p относительно нормальной ткани прямой кишки в 3,90 (p = 0,00075) раза выше у больных с полным регрессом опухоли и в 10,00 раз (p < 0,00022) ниже у больных с частичным регрессом опухоли. При этом между этими группами отличия в экспрессии miRNA-6798-5p составляет 39,00 раз (p = 0,000002) (рис. 3). Экспрессия miRNA-6865-5p снижена в 3,30 раза (p = 0,003) в опухолевой ткани у больных с неполным регрессом опухоли относительно нормальной ткани прямой кишки.

Так как микроРНК имеют большое количество генов-мишеней [16], то для дифференциально экспрессирующихся микроРНК в опухолевых тканях двух групп больных РПК был проведен анализ ORA (Over-Representation Analysis, табл. 3, рис. 4).

Таблица 3

Представленность в сигнальных путях микроРНК с дифференциальной экспрессией

Сигнальный путь

P-value

МикроРНК

ECM-receptor interaction

5,53e-6

miRNA-195; miRNA-4257; miRNA-149; miRNA-138-1; miRNA-6798; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-557; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

Notch signaling pathway

1,87e-5

miRNA-195; miRNA-4257; miRNA-149; miRNA-6798; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-557; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

Protein digestion and absorption

2,98e-4

miRNA-195; miRNA-4257; miRNA-6798; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-557; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

Glutathione metabolism

7,10e-4

miRNA-195; miRNA-4257; miRNA-5187; miRNA-149; miRNA-138-1; miRNA-6798; miRNA-4728; miRNA-557; miRNA-1273h; miRNA-6808

Oxidative phosphorylation

9,45e-4

miRNA-195; miRNA-4257; miRNA-149; miRNA-138-1; miRNA-6798; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

RIG-I-like receptor signaling pathway

0,001412

miRNA-195; miRNA-4257; miRNA-5187; miRNA-6798; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-557; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-130b

Phosphatidylinositol signaling system

0,0021463

miRNA-195; miRNA-4257; miRNA-5187; miRNA-149; miRNA-6798; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-557; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-130b

Apoptosis – multiple species

0,0023771

miRNA-195; miRNA-4257; miRNA-149; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-557; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-130b

Phagosome

0,0023569

miRNA-195; miRNA-4257; miRNA-149; miRNA-138-1; miRNA-6798; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-557; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

Signaling pathways regulating pluripotency of stem cells

0,0028218

miRNA-195; miRNA-4257; miRNA-5187; miRNA-149; miRNA-138-1; miRNA-6798; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-557; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

Estrogen signaling pathway

0,0037057

miRNA-195; miRNA-4257; miRNA-5187; miRNA-149; miRNA-6798; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-557; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

Inflammatory mediator regulation of TRP channels

0,0040433

miRNA-195; miRNA-5187; miRNA-149; miRNA-6798; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-557; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-130b

Pyrimidine metabolism

0,0044015

miRNA-195; miRNA-4257; miRNA-149; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-130b

Inositol phosphate metabolism

0,0046988

miRNA-195; miRNA-4257; miRNA-149; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-557; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-130b

Necroptosis

0,0049473

miRNA-195; miRNA-4257; miRNA-5187; miRNA-149; miRNA-6798; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-557; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

Cell cycle

0,0061424

miRNA-195; miRNA-4257; miRNA-5187; miRNA-149; miRNA-138-1; miRNA-6798; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-557; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

Окончание табл. 3

Сигнальный путь

P-value

МикроРНК

ErbB signaling pathway

0,0059231

miRNA-195; miRNA-4257; miRNA-149; miRNA-138-1; miRNA-6798; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-557; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

Parathyroid hormone synthesis, secretion and action

0,0064135

miRNA-195; miRNA-4257; miRNA-149; miRNA-138-1; miRNA-6798; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

Ribosome biogenesis in eukaryotes

0,0057282

miRNA-195; miRNA-4257; miRNA-149; miRNA-138-1; miRNA-4728; miRNA-1249; miRNA-557; miRNA-1273h; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

VEGF signaling pathway

0,0077348

miRNA-195; miRNA-4257; miRNA-5187; miRNA-149; miRNA-6798; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-130b

C-type lectin receptor signaling pathway

0,0081841

miRNA-195; miRNA-4257; miRNA-5187; miRNA-149; miRNA-6798; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-557; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-130b

Phospholipase D signaling pathway

0,0088879

miRNA-195; miRNA-4257; miRNA-149; miRNA-138-1; miRNA-6798; miRNA-6819; miRNA-4728; miRNA-1249; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

Nitrogen metabolism

0,0097981

miRNA-195; miRNA-5187; miRNA-149; miRNA-4728; miRNA-1273h; miRNA-6808

Согласно Over-Representation Analysis, дифференциально экспрессирующиеся в двух группах пациентов микроРНК не только оказывают влияние на уровень мРНК генетических локусов BCL-2, CASP-9, BRCA-2, RAD50, H2AX и RBBP-8, но и контролируют ключевые для выживания и пролиферации опухолевых клеток сигнальные пути (табл. 3, рис. 4).

missing image file

Рис. 4. Визуализация результатов ORA, представленных в табл. 3

Таким образом, радиочувствительность опухолевой ткани прямой кишки, определяющая эффективность лучевой терапии, также связана с уровнем микроРНК miRNA-195, miRNA-4257, miRNA-5187, miRNA-149, miRNA-138, miRNA-6798, miRNA-6820, miRNA-557, miRNA-6757, miRNA-1249, miRNA-1273h, miRNA-6737, miRNA-6819, miRNA-6874, miRNA-4728, miRNA-6808, miRNA-3202, miRNA-5195-3p и miRNA-130b.

Биоинформационный скрининг потенциального взаимодействия микроРНК и длинных некодирующих РНК. Применение биоинформационных алгоритмов позволило выявить для пяти дифференциально экспрессирующихся микроРНК (miR-130b, miR-149, miR-195, miR-1249, miR-5195) взаимодействие с 202 длинными некодирующими РНК (табл. 4).

Таблица 4

Перечень длинных некодирующих РНК и взаимодействующих с ними микроРНК

МикроРНК

Lncrna-мишень

Последовательность микроРНК

Выравнивание

Последовательность длинной некодирующей РНК

hsa-miR-130b-3p

LINC01087

uacGGGAAAGUAGUAACGUGAc

:| | | : |||||||||

uauUCGUCUGGACAUUGCACUu

 

AC016717.2

uaCGGGAAAGUAGUAACGUGAc

|:|:| |:||| |||||||

agGUCUUGUUAUC-UUGCACUa

 

AC109588.1

uacgggaaagUAGUAACGUGAc

| | |||||||

uacuuaauaaAACCUUGCACUc

 

AC124016.2

uacgggAAAGUAGUAACGUGAc

|||:| : |||||||

auagggUUUUAAU-UUGCACUg

 

LINC01091

uacgggaaAGUAGUAACGUGAc

| :|| |||||||

gccuaggcUGGUC-UUGCACUc

 

AL591030.1

uacgggaAAGUAGUAACGUGAc

| :||: |||||||

gacagaaUAUAUU-UUGCACUa

 

AP003469.4

uacgggaaaguagUAACGUGAc

||||||||

uauucagccuggaAUUGCACUa

 

AL845472.1

uaCGGGA--AAGUAGUAACGUGAc

|||:| | | | :|||||||

ugGCCUUCAUCCCUAGUUGCACUa

 

PCAT5

uacGGGAAAGUAGU--AACGUGAc

|||| ::||| |||||||

ucuCCCUGCUGUCACUUUGCACUu

 

LINC00839

uacGGGA--AA-

GUAGUAACGUGAc

|||| || | | |||||||

uccCCCUGAUUCCCACUUUGCACUu

 

NEAT1

uacGGGAAAGUAGUAACGUGAc

|: || ::|| |||||||

ggaCUGUUCUGUCCUUGCACUg

 

LINC01089

uacGGGAAAGUAGUAACGUGAc

:|| | |||||||||

gcuUCCAACCUCCAUUGCACUg

 

AL355338.1

uacgggaAAGUAGUAACGUGAc

| || |||||||||

cugagacUGCACCAUUGCACUc

 

VASH1-AS1

uacgggaaAGUA--GUAACGUGAc

|||| |||||||||

agccgagaUCAUGCCAUUGCACUc

 

AC142472.1

uaCGGGAAAGUAGU---

AACGUGAc

| | || || || |||||||

cuGACAUUCCAGCACGUUUGCACUg

 

LINC01476

uacGGGAAAGUAGU-AACGUGAc

|| | ||| | |||||||

aucCCAUGACAUGAUUUGCACUc

 

LINC00667

uacGGGAAAGUAGUAACGUGAc

|:|| | : | |||||||

aauCUCUAU-GCCUUUGCACUg

 

ILF3-AS1

uacgggAAAGUAGUAACGUGAc

|| | |||||||||

ccgagaUUGCUCCAUUGCACUc

 

CTD-3093M3.1

uacgggaaaguaguAACGUGAc

|||||||

uauuuguaaaaaauUUGCACUu

 

LINC02575

uacgggaaaGUAGUAACGUGAc

|| | |||||||

acucaauaaCA-CUUUGCACUc

 

XIST

uacgggaAAGUAGU-AACGUGAc

||| ||| |||||||

uaaacaaUUC-UCAGUUGCACUu

hsa-miR-149-5p

AL645608.1

ccCUCACUUCUGUGC-

CUCGGUCu

|: ||:||:|: | |||||||

cgGGAUGGAGGCGGGAGAGCCAGg

 

LINC01356

cccucacuucUGUGCCUCGGUCu

|| ||||||||

uuuaauacccACCAGGAGCCAGu

 

BLACAT1

cccUCACUUCUGUGCCUCGGUCu

| ||| :| ||||||||

agcACUGA--GCUGGGAGCCAGg

 

AC007878.1

cccucACUUCUGUGCCUCGGUCu

||:: | || |||||||

cagccUGGGCA-ACAGAGCCAGg

 

AC009237.14

cccucacUUCUGUGCCUCGGUCu

|||:| |||||||

gaagcacAAGGCUGAGAGCCAGu

 

MIR4435-2HG

cccUCACUUCUG--UG-

CCUCGGUCu

||| | :| |: ||||||||

uccAGUAAUUGCUAAUGGGAGCCAGu

 

AC079922.2

cccUCAC-UUCUGUGCCUCGGUCu

|||| : || : |||||||

ugcAGUGUGUCACCUUGAGCCAGu

 

AC097468.3

ccCUCACUUCUGUGCCUCGGUCu

|| ||| | ||||||||

auGAAUGACCCAAAGGAGCCAGg

 

AC109779.1

ccCUCACUUCUGUGC---CUCGGUCu

|: || |::|:| |||||||

guGGCUGCUGGUAUGCAUGAGCCAGc

 

AC131235.4

cccucACUUCUGUGC---CUCGGUCu

|| |::|:| |||||||

uuauaUGCUGGUAUGCCAGAGCCAGa

 

MUC20-OT1

cccucACUUCUGUGCCUCGGUCu

| ::|::| ||||||||

uguuuUAGGGGUA-GGAGCCAGg

 

AC024132.1

cccUC-ACUUCUGUGCCUCGGUCu

|| ||:| : |||||||

cucAGCUGGACCAGAAGAGCCAGa

 

SNHG8

cccuCACUU--CUGU--GCCUCGGUCu

| ||| | || : |||||||

ccccGAGAACCGUCAGUUUGAGCCAGa

 

SCAMP1-AS1

cccUC-ACUUC--UGUGCCUCGGUCu

|| ||||| ||| ||||||||

cuuAGAUGAAGCUACAGGGAGCCAGa

 

LINC01554

cccucacuucuguGCCUCGGUCu

| |||||||

cgcagcuucacucCUGAGCCAGc

 

LINC01848

ccCUCACUUCUGUGCCUCGGUCu

||| |:|| |:||||||||

uuGAG-GGAGCAAUGGAGCCAGc

 

AC094104.1

cccuCACUUCUGUGCCUCGGUCu

|||::|| | |||||||

gaacGUGGGGA-AGUGAGCCAGg

 

C5orf66-AS1

cccuCACUUCUGUGCCUCGGUCu

||| || | |||||||

aaccGUGCAGUGCCAGAGCCAGa

 

AL390955.2

cccucACUUCUGUGCCUCGGUCu

||:||: | |||||||

cucccUGGAGG-A--GAGCCAGc

 

AC092171.3

ccCUCACUUCUGUGCCUCGGUCu

||| |:||:| |||||||||

ggGAGCGGAGGC-CGGAGCCAGc

 

AC005537.1

ccCUCA-CUUCUGUGCCUCGGUCu

| || |:| | | |||||||

ggGCGUAGGACCCUCCGAGCCAGg

 

AC078846.1

cccucacUUCUGUG--CCUCGGUCu

|||:::| |||||||

accaaaaAAGGUGCCUUGAGCCAGa

Продолжение табл. 4

МикроРНК

Lncrna-мишень

Последовательность микроРНК

Выравнивание

Последовательность длинной некодирующей РНК

 

AL158152.1

cccUCACU-UCUG--UGCCUCGGUCu

| ||| ||:: |: |||||||

uucAUUGAUAGGUUGAUUGAGCCAGa

 

AL365199.1

cccucaCUUCUGU-GCCUCGGUCu

|: |::| :||||||||

acccaaGGUGGUAUUGGAGCCAGg

 

LINC01468

cccucaCUUCUGUGC---CUCGGUCu

|||||:: | |||||||

aaacugGAAGAUGAGGAAGAGCCAGc

 

OLMALINC

cccucacuucUGUGCCUCGGUCu

| :| |||||||

gcuccucgccAGGCUGAGCCAGg

 

C10orf91

cccucacuucugugcCUCGGUCu

|||||||

cacaggcggcuggaaGAGCCAGu

 

NEAT1

cccUCACUUC-UGUG-C-CUCGGUCu

|| ||| || | | |||||||

aaaAGGAAAGUACCCUGAGAGCCAGu

 

MALAT1

ccCUCACUUCUGUGCCUCGGUCu

|| :|| | ||||||||

agGAAAAGAGUCCAGGAGCCAGu

 

AC012531.1

cccucacuucuguGCCUCGGUCu

| |||||||

uccucgucgcuauCUGAGCCAGg

 

AC023794.6

cccucacuucuGUGCCUCGGUCu

||| |||||||

ccaccccugucCACAGAGCCAGg

 

HELLPAR

cccUCACUU-CUGUGCCUCGGUCu

||| || ||:: |||||||

aaaAGUUAAUGAUGGUGAGCCAGg

 

AC125603.2

cccucacuucuguGCCUCGGUCu

| |||||||

ugcagcuucacucCUGAGCCAGc

 

LINC00943

ccCUCACUUCUGUGCCUCGGUCu

|: ||| :|| ||||||||

caGGCUGA--GCAAGGAGCCAGu

 

LINC01257

cccUCACUUCUGUGCCUCGGUCu

:||| :|: :| |||||||

cgcGGUGCGGGAGCAGAGCCAGc

 

AF111169.1

cccucaCUUCUG-UGCCUCGGUCu

||| || : ||||||||

ggggcaGAACACUGGGGAGCCAGg

 

VASH1-AS1

ccCU-CACUUCUGU-GCCUCGGUCu

|| || : :|| | |||||||

caGAUGUUGCUGCAGCUGAGCCAGa

 

LINC02288

cccuCACUUCUGUGCCUCGGUCu

|| ||| | ||||||||

cccuGUCUAGA-A-GGAGCCAGu

 

DRAIC

ccCUCAC-UUCUGUGCCUCGGUCu

||| | : |:||| |||||||

cuGAGAGCGCGGCAC-GAGCCAGa

 

LINC02188

cccUCACUUCUGUGCCUCGGUCu

:||| ||| : |||||||

gaaGGUGUAGA-GGAGAGCCAGg

 

RP1-178F10.3

cccucacuucuGUGCCUCGGUCu

||:||||||||

aucgaggucauCAUGGAGCCAGc

 

AC068512.1

cccucacuUCUGUGCCUCGGUCu

|| : :||||||||

ggcccuacAGCUUUGGAGCCAGg

 

AC006504.5

cccUCACUUC-UGUGCCUCGGUCu

|| | | :: | |||||||

uccAGGCAUGUGUCCUGAGCCAGg

 

AL121894.2

cccucACUUCUGUGCCUCGGUCu

|||:| || |||||||

ccccaUGAGGCCAGUGAGCCAGa

 

LINC00895

cccucaCUUCUG-UGCCUCGGUCu

||:|:| : |||||||

uuguuaGAGGGCUGAAGAGCCAGc

 

OGFRP1

ccCUCACUUCUGUGC-CUCGGUCu

|| | : | | | |||||||

guGACUUGUGCGAAGUGAGCCAGg

 

MIRLET7BHG

cccUCACUUC-UGUGCCUCGGUCu

| |||:| || |||||||

gaaACUGAGGCCCAGAGAGCCAGg

 

XIST

cccucacuUCUGUGCCUCGGUCu

|| | : |||||||

ccugggccAGUC-UUGAGCCAGc

 

FTX

cccucaCUUCUGUGCCUCGGUCu

||| : | |||||||

ugcgcaGAACUUCCCGAGCCAGc

 

LINC00630

cccucacuucugugcCUCGGUCu

|||||||

ugucugucaccuuaaGAGCCAGu

 

DANT2

cccucacuucuguGCCUCGGUCu

| |||||||

uauaaacgcucucCUGAGCCAGu

 

MIR503HG

cccucacuucuGUGCCUCGGUCu

| :||||||||

guacgguucccCCUGGAGCCAGa

hsa-miR-195-5p

AL645608.3

cgGUUAUAAAGAC---ACGACGAu

| | | |||| |||||||

ccCCAGAGCUCUGCCCUGCUGCUg

 

AL031281.2

cggUUAUA-AAGACACGACGAu

| ||| | || |||||||

gugAUUAUCUCCUCUGCUGCUa

 

AL691459.1

cgguuauaaagacACGACGAu

|||||||

uuaggaaagagaaUGCUGCUa

 

RP6-206I17.2

cgGUUAUAAAGACACGACGAu

|||| || | |||||||

ccCAAUUUUAC--UGCUGCUg

 

RASAL2-AS1

cgguuauaaAGACACGACGAu

||| |||||||

cgguccgggUCUCUGCUGCUc

 

MIR29B2CHG

cgguuauaaagacACGACGAu

|||||||

acugcagaggaacUGCUGCUc

 

LINC01703

cgguuauaaagacACGACGAu

|||||||

cgugauuagagauUGCUGCUg

 

AC108488.1

cgguuauaaagacACGACGAu

|||||||

gcuuugugaagaaUGCUGCUg

 

AC010969.2

cggUUAUAAAGACACGACGAu

::| || || |||||||

uggGGUCUUGCUAUGCUGCUc

 

AC104794.2

cgguuauaaaGACACGACGAu

|| |||||||

gcuaugcacgCU-UGCUGCUa

 

AC073046.1

cgguuauAAAGAC-----ACGACGAu

|||||| |||||||

gaucccuUUUCUGAGGGCUGCUGCUg

 

AC019069.1

cgGUUAUAAAGACACGACGAu

| :|| || |||||||

gcCUGUA-GUCCCUGCUGCUc

 

TEX41

cgguuauaaagacACGACGAu

|||||||

agaugcauaaaauUGCUGCUu

 

LINC02478

cgguuauAAAGACACGACGAu

||||| |||||||

uuccuccUUUCU-UGCUGCUa

 

AC016717.2

cgGUUAUAAAGACACGACGAu

||||| ||| ||||||||

agCAAUAGUUCAGUGCUGCUc

 

AC097634.1

cggUUAUA-AAGAC--ACGACGAu

|| || ||: | |||||||

aaaAAGAUCUUUAGAUUGCUGCUa

 

LINC02035

cgguuauaaagacACGACGAu

|||||||

gcuuuacuuaaaaUGCUGCUu

 

AC107068.1

cgguUAUAAAGAC---ACGACGAu

|| | ||| |||||||

uguuAUCAUCCUGGGAUGCUGCUu

 

LINC02434

cgguuauaaagacACGACGAu

|||||||

ggagggaccagauUGCUGCUu

 

AC106799.3

cgGUU-AUAAAGACACGACGAu

||| | || || |||||||

aaCAAUUCUUCCUUUGCUGCUu

 

AC093297.2

cgGUUAUAAAGAC---ACGACGAu

||| |:|| |||||||

ugCAACCGCUUUGGAUUGCUGCUu

 

AC010245.2

cgguuaUAAAGACACGACGAu

||| | |||||||

cuuuccAUUGAUCUGCUGCUg

 

EPB41L4A-AS1

cgguuauaaagacACGACGAu

|||||||

cugaaguguagacUGCUGCUa

Продолжение табл. 4

МикроРНК

Lncrna-мишень

Последовательность микроРНК

Выравнивание

Последовательность длинной некодирующей РНК

 

LINC01184

cgGUUAUA--AAGAC-ACGACGAu

:|:|:| || || |||||||

uuUAGUGUCAUUAUGUUGCUGCUa

 

HCG17

cgguuauaaagacACGACGAu

|||||||

ugcuuugcccgccUGCUGCUg

 

LINC00473

cgguuaUAAA-GAC--ACGACGAu

|||| ||| |||||||

agggccAUUUCCUGUUUGCUGCUu

 

AC004852.2

cgGUUAUAA-AGACACGACGAu

||| ||| | |||||||

uuCAAAAUUGCCACUGCUGCUg

 

AC005537.1

cgGUUAUAAAGACACGACGAu

||||| : |||||||

cuCAAUAAAAU--UGCUGCUa

 

AC118758.3

cgguuauaaagACACGACGAu

| |||||||

caggccuagcgUUUGCUGCUu

 

AC003092.1

cgGUUA-UA-AAGACACGACGAu

|| | || | || |||||||

cuCACUCAUCUGCUAUGCUGCUg

 

CASC9

cgguuauaaagACACGACGAu

| |||||||

agauggacacaUUUGCUGCUu

 

RNF139-AS1

cgguuAUAAAGACACGACGAu

||||| |||||||

uugguUAUUU-AAUGCUGCUu

 

PVT1

cgguuauaAAGAC-ACGACGAu

| ||| |||||||

uuugcuucUCCUGUUGCUGCUa

 

C9orf163

cgguuauaaaGACACGACGAu

|| |||||||

ccugguggggCUUUGCUGCUu

 

LINC00707

cgguUAUAAAGAC---ACGACGAu

| | |||| |||||||

cugcAGACAUCUGGACUGCUGCUu

 

LINC00843

cgguuauAAAGACACGACGAu

| | |||||||||

uccccguUCUGUGUGCUGCUg

 

AC022400.5

cgguuauAAAGACACGACGAu

| | |||||||||

uccccguUCUGUGUGCUGCUg

 

AL132656.2

cgGUUAUAAAGACACGACGAu

| | ||| | |||||||

aaCCACAUUCC--UGCUGCUg

 

AL160290.2

cggUUAUAAAGACACGACGAu

|: | || ||||||||

cagAGGAGCUCCGUGCUGCUa

 

AL158835.1

cgguUAUAAAGACACGACGAu

||||| | |||||||

auucAUAUUCAUUUGCUGCUg

 

NEAT1

cgguuauaaagacACGACGAu

|||||||

cucgccuucacgcUGCUGCUg

 

AC008124.1

cggUUA--UAAAGACACGACGAu

||| | | || |||||||

caaAAUCCAAUCCU-UGCUGCUg

 

AC024884.2

cgguuauaAAGACACGACGAu

| || |||||||

cagcuuugUACUAUGCUGCUc

 

HELLPAR

cgguuauaaAGACACGACGAu

|| |||||||

ugcuucaaaUCAUUGCUGCUu

 

AC055713.1

cgguuAUAA-AGACACGACGAu

|||| |: |||||||

uuggcUAUUAUUAAUGCUGCUa

 

LINC00943

cgguuauAAAGACACGACGAu

|| || |||||||

uagucacUUCCUCUGCUGCUg

 

AL139327.2

cgguuAUAAAGAC-ACGACGAu

| || | | |||||||

uuuuuUUUUCCAGAUGCUGCUg

 

AL138820.1

cgguuauAAAGACACGACGAu

|| || |||||||

ucuugccUUACU-UGCUGCUu

 

LINC00639

cgGUUAUA-AAGACACGACGAu

:|| || | | |||||||

ugUAAGAUGUGAUUUGCUGCUc

 

AL355916.1

cgguuauaaAGACACGACGAu

|| ||||||||

ucucugaccUCAGUGCUGCUg

 

AL049775.1

cgguuauaaagacACGACGAu

|||||||

gaggcugugggaaUGCUGCUu

 

MEG3

cgGU-UAUAAAGACACGACGAu

|| ||:| | |||||||

caCACAUGUGGCCUUGCUGCUg

 

MEG8

cgguuauaaaGACACGACGAu

|| |||||||

auuuaaccacCU-UGCUGCUg

 

AL117190.1

cgguuauaaaGACACGACGAu

|| |||||||

auuuaaccacCU-UGCUGCUg

 

LINC00638

cgGUUAUAAAGACACGACGAu

| | | || |||||||

gcCCAGCUGUCCAUGCUGCUg

 

FAM30A

cgguuauaaagacACGACGAu

|||||||

agagggaaagggaUGCUGCUg

 

AC012236.1

cgguuauaaagacACGACGAu

|||||||

agagaggggcaccUGCUGCUa

 

AC020661.1

cggUUAUAAAGACACGACGAu

|| | | |||||||||

ugaAAGACAU-UGUGCUGCUg

 

IQCH-AS1

cgGUUAUAAAGA------CACGACGAu

||||: || | ||||||||

ucCAAUGAUUGUGGUGACGUGCUGCUa

 

AC068338.2

cggUUAUAAAGACACGACGAu

|| || | |||||||

acaAAGAUAAC-CUGCUGCUg

 

LINC02128

cgguuauaaaGAC--ACGACGAu

||| |||||||

uccgucagacCUGCCUGCUGCUu

 

LINC00922

cgguuauaaagacACGACGAu

|||||||

agcccugugagguUGCUGCUg

 

AC040162.3

cgGUUAUAAAGACACGACGAu

| ||| | |||||||

ugCUAUA-AACACUGCUGCUu

 

LINC01572

cgguUAUAAAGAC-ACGACGAu

|||| | | |||||||

uaucAUAUACCCGCUGCUGCUa

 

AC133540.1

cgguuauaAAGAC--ACGACGAu

| ||| |||||||

ccuuggccUGCUGGCUGCUGCUc

 

FENDRR

cggUUAUAAAGAC-----ACGACGAu

|||| | ||| |||||||

aggAAUA-UCCUGCAACCUGCUGCUc

 

AC126696.3

cgguuauaaAGAC-ACGACGAu

|| | |||||||

aaagcuccaUCGGCUGCUGCUg

 

LINC00324

cgguuauaAAGACACGACGAu

|| | |||||||

uccgcccgUUAU-UGCUGCUc

 

RP1-178F10.3

cgguuauaaagacACGACGAu

|||||||

uucuguuggcgccUGCUGCUg

 

AC129926.1

cgGUU-AUAAAGAC-ACGACGAu

||: |: |||| |||||||

ucCAGCUGCCUCUGCUGCUGCUg

 

SNHG25

cgguUAUAAAGACACGACGAu

|| | || |||||||

ugucAUCGUCCU-UGCUGCUu

 

LINC00511

cggUUAUAAA-GACACGACGAu

|:|:||| || |||||||

gaaAGUGUUUCCUCUGCUGCUa

 

AC090772.3

cggUUAUAAAGAC--ACGACGAu

| | || || |||||||

gugACUUUUGGUGGAUGCUGCUg

 

AC068473.5

cgguuauAAAGACACGACGAu

| ||| |||||||

uuuugacUAUCUCUGCUGCUu

 

LINC00662

cggUUAUAAAGAC-ACGACGAu

|||: | ||| |||||||

cugAAUGGUACUGCUGCUGCUg

 

SCGB1B2P

cgguuauaaagacACGACGAu

|||||||

cuagcucccgcccUGCUGCUg

 

LINC00665

cgGUUAUAAAG-ACACGACGAu

:| |: | | | |||||||

gaUACUGCUCCUUUUGCUGCUu

 

AC010624.2

cgguuauaaaGAC-ACGACGAu

||| |||||||

gguccccccaCUGCUGCUGCUa

 

AC005261.1

cgguuauaaagacACGACGAu

|||||||

cacugauuaaaacUGCUGCUu

 

AL035252.3

cgguuauaaAGACACGACGAu

|| |||||||

cucuaggccUCACUGCUGCUu

Окончание табл. 4

МикроРНК

Lncrna-мишень

Последовательность микроРНК

Выравнивание

Последовательность длинной некодирующей РНК

 

SMIM25

cgguuauaaagacACGACGAu

|||||||

ccacugccaccacUGCUGCUc

 

AP001432.1

cgGUUAUAAAGACACGACGAu

||:| || |||||||

cuCAGU-CAUCACUGCUGCUu

 

LINC01547

cgguuauaAAGACACGACGAu

| || |||||||

cggccccgUCCUCUGCUGCUg

 

AP001476.1

cgguuauaaagacACGACGAu

|||||||

cgggcgagcccgaUGCUGCUc

 

AP000547.3

cgGUUAUAAAGAC-ACGACGAu

|::|| ||| |||||||

ccCGGUA--CCUGCUGCUGCUc

 

BX890604.1

cgguuauaaagacACGACGAu

|||||||

cgaggccggcggcUGCUGCUa

 

FAM239A

cgguuauaaagacACGACGAu

|||||||

cgaggccggcggcUGCUGCUa

 

FAM239B

cgguuauaaagacACGACGAu

|||||||

uaccuggggccguUGCUGCUu

 

XIST

cgGUUAUAAAGACACGACGAu

|||| | | | |||||||

gcCAAUUUGUGUUUGCUGCUc

 

MIR503HG

cggUUAUAAAGACACGACGAu

|||: | | |||||||

uugAAUGACUGUAUGCUGCUu

hsa-miR-1249-3p

AC239800.3

acuucuuccccccCUUCCCGCa

||||||||

gacucugaaaccaGAAGGGCGg

 

AL391069.4

acuucuuccccccCUUCCCGCa

||||||||

cgcuggguuccuaGAAGGGCGc

 

TERC

acuucuuccccCCCUUCCCGCa

| ||||||||

uaacccuaacuGAGAAGGGCGu

 

AC008392.1

acuucuucccccccUUCCCGCa

|||||||

ccucaguacuguaaAAGGGCGg

 

LINC01547

acuucuucccccccUUCCCGCa

|||||||

ucggcuucagaauaAAGGGCGc

 

XIST

acuucuucccccccUUCCCGCa

|||||||

ucugcaguuaagcuAAGGGCGu

hsa-miR-5195-3p

LINC01355

ucGGGGGAGUCU-C-UUGACCUa

| |::| | | | |||||||

caCACUUUAAAAUGUAACUGGAu

 

AL365181.2

ucgggggagUCU-CUUGACCUa

:|| ||||||||

agaacagcgGGAGGAACUGGAg

 

AC097634.1

ucGGGGGAGUC--U-CUUGACCUa

|::: |||| | |||||||

uuCUUUAUCAGUAAUCAACUGGAa

 

MUC20-OT1

ucggggGAGUCUCUUGACCUa

|| :| |||||||

caugggCUGGGCCAACUGGAa

 

AC093297.2

ucgggggAGUCUC--UUGACCUa

| :|:| |||||||

uuuagaaUAGGGGCAAACUGGAa

 

AL008729.2

ucGGGGGAGUCUC-UUGACCUa

| ||| : || |||||||

gaCACCCAGGAAGCAACUGGAa

 

AC008080.1

ucgGGGGAGUCUCUUGACCUa

|:||| || |||||||

cagCUCCU--GA-AACUGGAa

 

AC016831.5

ucgggGGAGUCUCUUGACCUa

|:|| | |||||||

cuuugCUUCCCAUAACUGGAa

 

CASC9

ucgGGGGAGUCUCUUGACCUa

||::|| |||||||

gaaCCUUUC----AACUGGAu

 

PVT1

ucggGGGAGUCUCUUGACCUa

|| || |:||||||||

guugCCAUCUGGGAACUGGAu

 

C9orf170

ucgggggagUCUCUUGACCUa

|||||||||||

augugggggAGAGAACUGGAg

 

LINC00707

ucgggggaGUCUCUUGACCUa

|||| |||||||

ugcagugcCAGAAAACUGGAa

 

LINC01468

ucGGGGGAGUCUCUUGACCUa

|:|| |:: | |||||||

caCUCCAUUGUA-AACUGGAa

 

MALAT1

ucgggggaGUCUCUUGACCUa

::|| |||||||

guuugaagUGGAAAACUGGAa

 

AP003486.1

ucgggggagucuCUUGACCUa

||||||||

uacaaagaaguuGAACUGGAu

 

AC008124.1

ucgggggAGUCUCUUGACCUa

| ||| |||||||

gaugugaUGAGA-AACUGGAg

 

AC083805.1

ucGGGGGAGUCUCUUGACCUa

|| ||: |||||||

gcCCAACUUUCCUAACUGGAg

 

ATP2B1-AS1

ucGGGGGAGUCUCUUGACCUa

|:: |: |||||||||

cuCUUAAUUCCAGAACUGGAa

 

HELLPAR

ucgggggagucucUUGACCUa

|||||||

cauacguaucauuAACUGGAa

 

MAPKAPK5-AS1

ucGGGGGAGUCUCUUGACCUa

|:||:|| | |||||||

uaCUCCUUCUGCCAACUGGAa

 

LINC01089

ucgggggagucUCUUGACCUa

| |||||||

gaaacuagauuAAAACUGGAa

 

MEG3

ucGGGGGAGUCUCUUGACCUa

||: || || |||||||

caCCUGCU-AGCAAACUGGAg

 

IQCH-AS1

ucgggggagucucUUGACCUa

|||||||

uagaaaauacaccAACUGGAa

 

LINC00052

ucgggggagucucUUGACCUa

|||||||

aaaaccaaaugccAACUGGAg

 

AC092127.1

ucgGGGGAGUCU--C---UUGACCUa

||::|::|| | |||||||

agaCCUUUUGGAAGGCUUAACUGGAu

 

AC005920.3

ucgggggaGUCUCUUGACCUa

::| ||||||||

agagugaaUGGUGAACUGGAc

 

LINC00662

ucgggggagucUCUUGACCUa

| |||||||

auuuuauaauaAAAACUGGAa

 

AC012313.1

ucgggggagucucUUGACCUa

|||||||

caugaguucccccAACUGGAg

 

BX640515.1

ucgGGGGAGUCU---CUUGACCUa

|::|| ||: |||||||

uugCUUCUAAGGAUUAAACUGGAa

 

LINC01671

ucggGGGAGUCUCUUGACCUa

||| |||||||||||

gaagCCCAGAGAGAACUGGAc

 

BX890604.1

ucggggGAGUCU--CUUGACCUa

|| ||| ||||||||

gagaugCUGAGAAGGAACUGGAg

 

LINC01204

ucggGGGAGUCUCUUGACCUa

|| ||| |||||||

cugaCCAUCA-CUAACUGGAu

 

JPX

ucgggggagUC-UC-UUGACCUa

|| || |||||||

ucaaaggaaAGAAGCAACUGGAa

Для miR-130b предсказано взаимодействие с 21 lncRNA, для miR-149 – с 90 lncRNA, для miR-1249 – с 6 lncRNA и для miR-5195 – с 33 lncRNA. Из этого перечня длинных некодирующих РНК 24 взаимодействовали с несколькими микроРНК дифференциально экспрессирующимися у больных с разной эффективностью ЛТ (табл. 5, рис. 5).

Дальнейшим этапом работы стал анализ представленности транскриптов 24 lncRNA в биологических образцах двух групп больных РПК.

Таблица 5

Перечень длинных некодирующих РНК 24, взаимодействующих с несколькими микроРНК, дифференциально экспрессирующимися у больных с разной эффективностью ЛТ

lncRNA

Число микроРНК взаимодействующих с lncRNA

МикроРНК

XIST

4

hsa-miR-130b-3p, hsa-miR-149-5p, hsa-miR-195-5p, hsa-miR-1249-3p

HELLPAR

3

hsa-miR-149-5p, hsa-miR-195-5p, hsa-miR-5195-3p

NEAT1

3

hsa-miR-130b-3p, hsa-miR-149-5p, hsa-miR-195-5p

AC005537.1

2

hsa-miR-149-5p, hsa-miR-195-5p

AC008124.1

2

hsa-miR-195-5p, hsa-miR-5195-3p

AC016717.2

2

hsa-miR-130b-3p, hsa-miR-195-5p

AC093297.2

2

hsa-miR-195-5p, hsa-miR-5195-3p

AC097634.1

2

hsa-miR-195-5p, hsa-miR-5195-3p

BX890604.1

2

hsa-miR-195-5p, hsa-miR-5195-3p

CASC9

2

hsa-miR-195-5p, hsa-miR-5195-3p

IQCH-AS1

2

hsa-miR-195-5p, hsa-miR-5195-3p

LINC00662

2

hsa-miR-195-5p, hsa-miR-5195-3p

LINC00707

2

hsa-miR-195-5p, hsa-miR-5195-3p

LINC00943

2

hsa-miR-149-5p, hsa-miR-195-5p

LINC01089

2

hsa-miR-130b-3p, hsa-miR-5195-3p

LINC01468

2

hsa-miR-149-5p, hsa-miR-5195-3p

LINC01547

2

hsa-miR-195-5p, hsa-miR-1249-3p

MALAT1

2

hsa-miR-149-5p, hsa-miR-5195-3p

MEG3

2

hsa-miR-195-5p, hsa-miR-5195-3p

MIR503HG

2

hsa-miR-149-5p, hsa-miR-195-5p

MUC20-OT1

2

hsa-miR-149-5p, hsa-miR-5195-3p

PVT1

2

hsa-miR-195-5p, hsa-miR-5195-3p

RP1-178F10.3

2

hsa-miR-149-5p, hsa-miR-195-5p

VASH1-AS1

2

hsa-miR-130b-3p, hsa-miR-149-5p

missing image file

Рис. 5. Диаграмма Эйлера – Венна перекрывающихся взаимодействий 5 микроРНК и 202 длинных некодирующих РНК

Особенности экспрессии lncRNA и эффективность лучевой терапии. Анализ относительной представленности транскриптов длинных некодирующих РНК показал дифференциальные отличия по этому показателю двух групп пациентов с разным ответом на ЛТ. Так, у больных с полным ответом на лучевую терапию обнаружено статистически значимое (р < 0,05) снижение представленности транскриптов lncRNA XIST, HELLPAR, NEAT1, AC008124.1 и AC016717.2 в 2,5; 3,3; 2,0; 2,0 и 5,0 раз соответственно относительно нормальной ткани, а у больных с частичным ответом/ отсутствием ответа на лучевую терапию обнаружено статистически значимое (р < 0,05) увеличение представленности транскриптов lncRNA XIST, HELLPAR, NEAT1, AC008124.1, LINC01089, LINC01547 и VASH1-AS1 в 1,9; 2,9; 3,5; 3,7; 2,6; 4,7 и 1,9 раза соответственно относительно нормальной ткани. При этом между двумя группами пациентов по уровню представленности транскриптов lncRNA XIST, HELLPAR, NEAT1, AC008124.1, AC016717.2, LINC01089, LINC01547 и VASH1-AS1 также наблюдались статистически значимые отличия (р < 0,05) в 4,8; 9,7; 7,0; 7,4; 5,0; 3,1; 4,8 и 2,2 раза соответственно (рис. 6). Таким образом, полученные данные по представленности транскриптов длинных некодирующих РНК позволяют смоделировать сеть молекулярных взаимодействий, лежащих в основе радиорезистентности опухолевых клеток.

missing image file

Рис. 6. Относительная представленность (относительно нормальной ткани) транскриптов длинных некодирующих РНК в опухолевой ткани прямой кишки двух групп больных с полным или частичным ответом / отсутствием ответа на ЛТ. * – статистически значимые отличия относительно нормальной ткани (р < 0,05), ** – межгрупповые статистически значимые отличия (р < 0,05)

Нарушения в регуляторной сети конкурентно-взаимодействующих РНК. Предыдущие этапы исследования позволили нам собрать необходимую информацию по всем компонентам регуляторной сети конкурентно-взаимодействующих эндогенных РНК (ceRNA), включая длинные некодирующие РНК (lncRNA), микроРНК (miRNA) и мРНК (экспрессия генов).

Комплексный анализ данных, представленных выше, позволил нам сформировать следующую модель (рис. 7). Снижение представленности транскриптов lncRNA XIST, HELLPAR, NEAT1, AC008124.1 и AC016717.2 у больных с полным ответом на лучевую терапию приводит к снижению эффективности взаимодействия lncRNA и таргетирующих их микроРНК (hsa-miR-130b-3p, hsa-miR-149-5p, hsa-miR-195-5p, hsa-miR-1249-3p, hsa-miR-5195-3p). Нарушение образования комплекса lncRNA-микроРНК приводит к увеличению количества свободных микроРНК hsa-miR-130b-3p, hsa-miR-149-5p, hsa-miR-195-5p и hsa-miR-5195-3p и их эффективному взаимодействию с генами-мишенями (мРНК). Соответственно снижается представленность транскриптов генов-мишеней микроРНК hsa-miR-130b-3p, hsa-miR-149-5p, hsa-miR-195-5p – RBBP8 и miR-5195-3p – H2AX, а следовательно, происходит снижение эффективности репарации ДНК.

missing image file

Рис. 7. Особенности регуляторной сети конкурентно-взаимодействующих РНК у больных с разным ответом на ЛТ

Противоположный эффект наблюдается у больных с плохим ответом на ЛТ. Увеличение представленности транскриптов lncRNA XIST, HELLPAR, NEAT1, AC008124.1, LINC01089, LINC01547 и VASH1-AS1 у этих больных приводит к увеличению эффективности взаимодействия lncRNA и микроРНК (hsa-miR-130b-3p, hsa-miR-149-5p, hsa-miR-195-5p, hsa-miR-1249-3p, hsa-miR-5195-3p). Образование комплекса lncRNA-микроРНК приводит к снижению количества свободных микроРНК hsa-miR-130b-3p, hsa-miR-149-5p, hsa-miR-195-5p и hsa-miR-5195-3p и снижению их взаимодействия с генами-мишенями (мРНК).

Соответственно увеличивается представленность транскриптов генов-мишеней микроРНК hsa-miR-130b-3p, hsa-miR-149-5p, hsa-miR-195-5p – RBBP8 и miR-5195-3p – H2AX, а следовательно, происходит увеличение эффективности репарации ДНК и формирование радиорезистентности (рис. 7).

Заключение

Комплексный анализ особенностей регуляторной сети конкурентно-взаимодействующих РНК и эффективности лучевой терапии опухолей прямой кишки позволил установить как механизмы формирования радиорезистентности, так и её предикторы. Эффективность лучевой терапии злокачественных опухолей прямой кишки связана с уровнем микроРНК (miR-195; miR-1273h; miR-6737; miR-6808; miR-3202; miR-5195; miR-4257; miR-5187; miR-149; miR-138; miR-6798; miR-6819; miR-4728; miR-1249; miR-557; miR-130b) и lncRNA (XIST, HELLPAR, NEAT1, AC008124.1, LINC01089, LINC01547 и VASH1-AS1), обеспечивающих эффективную регуляцию систем репарации ДНК (H2AX и RBBP-8) и апоптоза (BCL-2).

Исследование выполнено в рамках госзадания «Поиск предикторов радиорезистентности рака прямой кишки и разработка персонифицированных неоадъювантных терапевтических подходов».


Библиографическая ссылка

Кутилин Д.С., Гусарева М.А., Кошелева Н.Г., Зинькович М.С., Савченко Д.А., Шляхова О.В., Фатькина Н.Б., Удаленкова И.А., Гаппоева М.А., Толмачева Е.А. НАРУШЕНИЯ В РЕГУЛЯТОРНОЙ СЕТИ КОНКУРЕНТНО-ВЗАИМОДЕЙСТВУЮЩИХ РНК И РАДИОРЕЗИСТЕНТНОСТЬ ОПУХОЛЕЙ ПРЯМОЙ КИШКИ // Международный журнал прикладных и фундаментальных исследований. – 2021. – № 11. – С. 12-29;
URL: https://applied-research.ru/ru/article/view?id=13306 (дата обращения: 13.08.2022).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074